ID: 904428145

View in Genome Browser
Species Human (GRCh38)
Location 1:30444912-30444934
Sequence CGTGCAAGTGGAGCACATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904428145_904428150 12 Left 904428145 1:30444912-30444934 CCTGCATGTGCTCCACTTGCACG No data
Right 904428150 1:30444947-30444969 TCCTGAAAGCAGTCTGCTCTGGG No data
904428145_904428149 11 Left 904428145 1:30444912-30444934 CCTGCATGTGCTCCACTTGCACG No data
Right 904428149 1:30444946-30444968 ATCCTGAAAGCAGTCTGCTCTGG No data
904428145_904428152 26 Left 904428145 1:30444912-30444934 CCTGCATGTGCTCCACTTGCACG No data
Right 904428152 1:30444961-30444983 TGCTCTGGGTTCTGTACCCCAGG No data
904428145_904428153 27 Left 904428145 1:30444912-30444934 CCTGCATGTGCTCCACTTGCACG No data
Right 904428153 1:30444962-30444984 GCTCTGGGTTCTGTACCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904428145 Original CRISPR CGTGCAAGTGGAGCACATGC AGG (reversed) Intergenic
No off target data available for this crispr