ID: 904428896

View in Genome Browser
Species Human (GRCh38)
Location 1:30449202-30449224
Sequence CTGTTGATGGTGAGGCTCGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904428892_904428896 -7 Left 904428892 1:30449186-30449208 CCTGGGCCTGGAGAGGCTGTTGA No data
Right 904428896 1:30449202-30449224 CTGTTGATGGTGAGGCTCGATGG No data
904428883_904428896 13 Left 904428883 1:30449166-30449188 CCGGCCTGCTGCCTGCCAGCCCT No data
Right 904428896 1:30449202-30449224 CTGTTGATGGTGAGGCTCGATGG No data
904428890_904428896 -2 Left 904428890 1:30449181-30449203 CCAGCCCTGGGCCTGGAGAGGCT No data
Right 904428896 1:30449202-30449224 CTGTTGATGGTGAGGCTCGATGG No data
904428891_904428896 -6 Left 904428891 1:30449185-30449207 CCCTGGGCCTGGAGAGGCTGTTG No data
Right 904428896 1:30449202-30449224 CTGTTGATGGTGAGGCTCGATGG No data
904428886_904428896 9 Left 904428886 1:30449170-30449192 CCTGCTGCCTGCCAGCCCTGGGC No data
Right 904428896 1:30449202-30449224 CTGTTGATGGTGAGGCTCGATGG No data
904428888_904428896 2 Left 904428888 1:30449177-30449199 CCTGCCAGCCCTGGGCCTGGAGA No data
Right 904428896 1:30449202-30449224 CTGTTGATGGTGAGGCTCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904428896 Original CRISPR CTGTTGATGGTGAGGCTCGA TGG Intergenic
No off target data available for this crispr