ID: 904430743

View in Genome Browser
Species Human (GRCh38)
Location 1:30462545-30462567
Sequence AACAACGTGCCCGCTGTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904430743_904430748 2 Left 904430743 1:30462545-30462567 CCCTTCACAGCGGGCACGTTGTT No data
Right 904430748 1:30462570-30462592 GTCTTTGCAGGACTGGGCTGCGG No data
904430743_904430759 28 Left 904430743 1:30462545-30462567 CCCTTCACAGCGGGCACGTTGTT No data
Right 904430759 1:30462596-30462618 GGGGAAGGGGGTAGGCACACAGG No data
904430743_904430745 -10 Left 904430743 1:30462545-30462567 CCCTTCACAGCGGGCACGTTGTT No data
Right 904430745 1:30462558-30462580 GCACGTTGTTTTGTCTTTGCAGG No data
904430743_904430750 6 Left 904430743 1:30462545-30462567 CCCTTCACAGCGGGCACGTTGTT No data
Right 904430750 1:30462574-30462596 TTGCAGGACTGGGCTGCGGGAGG No data
904430743_904430752 8 Left 904430743 1:30462545-30462567 CCCTTCACAGCGGGCACGTTGTT No data
Right 904430752 1:30462576-30462598 GCAGGACTGGGCTGCGGGAGGGG No data
904430743_904430753 9 Left 904430743 1:30462545-30462567 CCCTTCACAGCGGGCACGTTGTT No data
Right 904430753 1:30462577-30462599 CAGGACTGGGCTGCGGGAGGGGG No data
904430743_904430749 3 Left 904430743 1:30462545-30462567 CCCTTCACAGCGGGCACGTTGTT No data
Right 904430749 1:30462571-30462593 TCTTTGCAGGACTGGGCTGCGGG No data
904430743_904430754 13 Left 904430743 1:30462545-30462567 CCCTTCACAGCGGGCACGTTGTT No data
Right 904430754 1:30462581-30462603 ACTGGGCTGCGGGAGGGGGAAGG No data
904430743_904430747 -4 Left 904430743 1:30462545-30462567 CCCTTCACAGCGGGCACGTTGTT No data
Right 904430747 1:30462564-30462586 TGTTTTGTCTTTGCAGGACTGGG No data
904430743_904430755 14 Left 904430743 1:30462545-30462567 CCCTTCACAGCGGGCACGTTGTT No data
Right 904430755 1:30462582-30462604 CTGGGCTGCGGGAGGGGGAAGGG No data
904430743_904430751 7 Left 904430743 1:30462545-30462567 CCCTTCACAGCGGGCACGTTGTT No data
Right 904430751 1:30462575-30462597 TGCAGGACTGGGCTGCGGGAGGG No data
904430743_904430746 -5 Left 904430743 1:30462545-30462567 CCCTTCACAGCGGGCACGTTGTT No data
Right 904430746 1:30462563-30462585 TTGTTTTGTCTTTGCAGGACTGG No data
904430743_904430757 16 Left 904430743 1:30462545-30462567 CCCTTCACAGCGGGCACGTTGTT No data
Right 904430757 1:30462584-30462606 GGGCTGCGGGAGGGGGAAGGGGG No data
904430743_904430756 15 Left 904430743 1:30462545-30462567 CCCTTCACAGCGGGCACGTTGTT No data
Right 904430756 1:30462583-30462605 TGGGCTGCGGGAGGGGGAAGGGG No data
904430743_904430758 20 Left 904430743 1:30462545-30462567 CCCTTCACAGCGGGCACGTTGTT No data
Right 904430758 1:30462588-30462610 TGCGGGAGGGGGAAGGGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904430743 Original CRISPR AACAACGTGCCCGCTGTGAA GGG (reversed) Intergenic
No off target data available for this crispr