ID: 904432150

View in Genome Browser
Species Human (GRCh38)
Location 1:30471250-30471272
Sequence GGGAGTTTCTGAGGAAGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904432150_904432163 28 Left 904432150 1:30471250-30471272 CCTCCTCTTCCTCAGAAACTCCC No data
Right 904432163 1:30471301-30471323 TGCTCCTTTTTACCACCTTATGG No data
904432150_904432153 -4 Left 904432150 1:30471250-30471272 CCTCCTCTTCCTCAGAAACTCCC No data
Right 904432153 1:30471269-30471291 TCCCCAGTCACTCCCATCACAGG No data
904432150_904432164 29 Left 904432150 1:30471250-30471272 CCTCCTCTTCCTCAGAAACTCCC No data
Right 904432164 1:30471302-30471324 GCTCCTTTTTACCACCTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904432150 Original CRISPR GGGAGTTTCTGAGGAAGAGG AGG (reversed) Intergenic
No off target data available for this crispr