ID: 904432151

View in Genome Browser
Species Human (GRCh38)
Location 1:30471253-30471275
Sequence CTGGGGAGTTTCTGAGGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904432151_904432153 -7 Left 904432151 1:30471253-30471275 CCTCTTCCTCAGAAACTCCCCAG No data
Right 904432153 1:30471269-30471291 TCCCCAGTCACTCCCATCACAGG No data
904432151_904432164 26 Left 904432151 1:30471253-30471275 CCTCTTCCTCAGAAACTCCCCAG No data
Right 904432164 1:30471302-30471324 GCTCCTTTTTACCACCTTATGGG No data
904432151_904432163 25 Left 904432151 1:30471253-30471275 CCTCTTCCTCAGAAACTCCCCAG No data
Right 904432163 1:30471301-30471323 TGCTCCTTTTTACCACCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904432151 Original CRISPR CTGGGGAGTTTCTGAGGAAG AGG (reversed) Intergenic