ID: 904432152

View in Genome Browser
Species Human (GRCh38)
Location 1:30471259-30471281
Sequence GAGTGACTGGGGAGTTTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904432152_904432163 19 Left 904432152 1:30471259-30471281 CCTCAGAAACTCCCCAGTCACTC No data
Right 904432163 1:30471301-30471323 TGCTCCTTTTTACCACCTTATGG No data
904432152_904432164 20 Left 904432152 1:30471259-30471281 CCTCAGAAACTCCCCAGTCACTC No data
Right 904432164 1:30471302-30471324 GCTCCTTTTTACCACCTTATGGG No data
904432152_904432166 25 Left 904432152 1:30471259-30471281 CCTCAGAAACTCCCCAGTCACTC No data
Right 904432166 1:30471307-30471329 TTTTTACCACCTTATGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904432152 Original CRISPR GAGTGACTGGGGAGTTTCTG AGG (reversed) Intergenic