ID: 904432154

View in Genome Browser
Species Human (GRCh38)
Location 1:30471270-30471292
Sequence GCCTGTGATGGGAGTGACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904432154_904432172 28 Left 904432154 1:30471270-30471292 CCCCAGTCACTCCCATCACAGGC No data
Right 904432172 1:30471321-30471343 TGGGACAGGCAAAAGAGGGGAGG No data
904432154_904432163 8 Left 904432154 1:30471270-30471292 CCCCAGTCACTCCCATCACAGGC No data
Right 904432163 1:30471301-30471323 TGCTCCTTTTTACCACCTTATGG No data
904432154_904432169 23 Left 904432154 1:30471270-30471292 CCCCAGTCACTCCCATCACAGGC No data
Right 904432169 1:30471316-30471338 CCTTATGGGACAGGCAAAAGAGG No data
904432154_904432170 24 Left 904432154 1:30471270-30471292 CCCCAGTCACTCCCATCACAGGC No data
Right 904432170 1:30471317-30471339 CTTATGGGACAGGCAAAAGAGGG No data
904432154_904432164 9 Left 904432154 1:30471270-30471292 CCCCAGTCACTCCCATCACAGGC No data
Right 904432164 1:30471302-30471324 GCTCCTTTTTACCACCTTATGGG No data
904432154_904432166 14 Left 904432154 1:30471270-30471292 CCCCAGTCACTCCCATCACAGGC No data
Right 904432166 1:30471307-30471329 TTTTTACCACCTTATGGGACAGG No data
904432154_904432171 25 Left 904432154 1:30471270-30471292 CCCCAGTCACTCCCATCACAGGC No data
Right 904432171 1:30471318-30471340 TTATGGGACAGGCAAAAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904432154 Original CRISPR GCCTGTGATGGGAGTGACTG GGG (reversed) Intergenic
No off target data available for this crispr