ID: 904432156

View in Genome Browser
Species Human (GRCh38)
Location 1:30471272-30471294
Sequence GGGCCTGTGATGGGAGTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904432156_904432166 12 Left 904432156 1:30471272-30471294 CCAGTCACTCCCATCACAGGCCC No data
Right 904432166 1:30471307-30471329 TTTTTACCACCTTATGGGACAGG No data
904432156_904432173 30 Left 904432156 1:30471272-30471294 CCAGTCACTCCCATCACAGGCCC No data
Right 904432173 1:30471325-30471347 ACAGGCAAAAGAGGGGAGGCAGG No data
904432156_904432171 23 Left 904432156 1:30471272-30471294 CCAGTCACTCCCATCACAGGCCC No data
Right 904432171 1:30471318-30471340 TTATGGGACAGGCAAAAGAGGGG No data
904432156_904432163 6 Left 904432156 1:30471272-30471294 CCAGTCACTCCCATCACAGGCCC No data
Right 904432163 1:30471301-30471323 TGCTCCTTTTTACCACCTTATGG No data
904432156_904432172 26 Left 904432156 1:30471272-30471294 CCAGTCACTCCCATCACAGGCCC No data
Right 904432172 1:30471321-30471343 TGGGACAGGCAAAAGAGGGGAGG No data
904432156_904432169 21 Left 904432156 1:30471272-30471294 CCAGTCACTCCCATCACAGGCCC No data
Right 904432169 1:30471316-30471338 CCTTATGGGACAGGCAAAAGAGG No data
904432156_904432170 22 Left 904432156 1:30471272-30471294 CCAGTCACTCCCATCACAGGCCC No data
Right 904432170 1:30471317-30471339 CTTATGGGACAGGCAAAAGAGGG No data
904432156_904432164 7 Left 904432156 1:30471272-30471294 CCAGTCACTCCCATCACAGGCCC No data
Right 904432164 1:30471302-30471324 GCTCCTTTTTACCACCTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904432156 Original CRISPR GGGCCTGTGATGGGAGTGAC TGG (reversed) Intergenic
No off target data available for this crispr