ID: 904432163

View in Genome Browser
Species Human (GRCh38)
Location 1:30471301-30471323
Sequence TGCTCCTTTTTACCACCTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904432154_904432163 8 Left 904432154 1:30471270-30471292 CCCCAGTCACTCCCATCACAGGC No data
Right 904432163 1:30471301-30471323 TGCTCCTTTTTACCACCTTATGG No data
904432150_904432163 28 Left 904432150 1:30471250-30471272 CCTCCTCTTCCTCAGAAACTCCC No data
Right 904432163 1:30471301-30471323 TGCTCCTTTTTACCACCTTATGG No data
904432158_904432163 -4 Left 904432158 1:30471282-30471304 CCATCACAGGCCCTGTCCCTGCT No data
Right 904432163 1:30471301-30471323 TGCTCCTTTTTACCACCTTATGG No data
904432157_904432163 -3 Left 904432157 1:30471281-30471303 CCCATCACAGGCCCTGTCCCTGC No data
Right 904432163 1:30471301-30471323 TGCTCCTTTTTACCACCTTATGG No data
904432151_904432163 25 Left 904432151 1:30471253-30471275 CCTCTTCCTCAGAAACTCCCCAG No data
Right 904432163 1:30471301-30471323 TGCTCCTTTTTACCACCTTATGG No data
904432152_904432163 19 Left 904432152 1:30471259-30471281 CCTCAGAAACTCCCCAGTCACTC No data
Right 904432163 1:30471301-30471323 TGCTCCTTTTTACCACCTTATGG No data
904432155_904432163 7 Left 904432155 1:30471271-30471293 CCCAGTCACTCCCATCACAGGCC No data
Right 904432163 1:30471301-30471323 TGCTCCTTTTTACCACCTTATGG No data
904432156_904432163 6 Left 904432156 1:30471272-30471294 CCAGTCACTCCCATCACAGGCCC No data
Right 904432163 1:30471301-30471323 TGCTCCTTTTTACCACCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904432163 Original CRISPR TGCTCCTTTTTACCACCTTA TGG Intergenic