ID: 904432164

View in Genome Browser
Species Human (GRCh38)
Location 1:30471302-30471324
Sequence GCTCCTTTTTACCACCTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904432154_904432164 9 Left 904432154 1:30471270-30471292 CCCCAGTCACTCCCATCACAGGC No data
Right 904432164 1:30471302-30471324 GCTCCTTTTTACCACCTTATGGG No data
904432152_904432164 20 Left 904432152 1:30471259-30471281 CCTCAGAAACTCCCCAGTCACTC No data
Right 904432164 1:30471302-30471324 GCTCCTTTTTACCACCTTATGGG No data
904432157_904432164 -2 Left 904432157 1:30471281-30471303 CCCATCACAGGCCCTGTCCCTGC No data
Right 904432164 1:30471302-30471324 GCTCCTTTTTACCACCTTATGGG No data
904432158_904432164 -3 Left 904432158 1:30471282-30471304 CCATCACAGGCCCTGTCCCTGCT No data
Right 904432164 1:30471302-30471324 GCTCCTTTTTACCACCTTATGGG No data
904432156_904432164 7 Left 904432156 1:30471272-30471294 CCAGTCACTCCCATCACAGGCCC No data
Right 904432164 1:30471302-30471324 GCTCCTTTTTACCACCTTATGGG No data
904432151_904432164 26 Left 904432151 1:30471253-30471275 CCTCTTCCTCAGAAACTCCCCAG No data
Right 904432164 1:30471302-30471324 GCTCCTTTTTACCACCTTATGGG No data
904432150_904432164 29 Left 904432150 1:30471250-30471272 CCTCCTCTTCCTCAGAAACTCCC No data
Right 904432164 1:30471302-30471324 GCTCCTTTTTACCACCTTATGGG No data
904432155_904432164 8 Left 904432155 1:30471271-30471293 CCCAGTCACTCCCATCACAGGCC No data
Right 904432164 1:30471302-30471324 GCTCCTTTTTACCACCTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904432164 Original CRISPR GCTCCTTTTTACCACCTTAT GGG Intergenic
No off target data available for this crispr