ID: 904432166

View in Genome Browser
Species Human (GRCh38)
Location 1:30471307-30471329
Sequence TTTTTACCACCTTATGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904432159_904432166 -8 Left 904432159 1:30471292-30471314 CCCTGTCCCTGCTCCTTTTTACC No data
Right 904432166 1:30471307-30471329 TTTTTACCACCTTATGGGACAGG No data
904432156_904432166 12 Left 904432156 1:30471272-30471294 CCAGTCACTCCCATCACAGGCCC No data
Right 904432166 1:30471307-30471329 TTTTTACCACCTTATGGGACAGG No data
904432155_904432166 13 Left 904432155 1:30471271-30471293 CCCAGTCACTCCCATCACAGGCC No data
Right 904432166 1:30471307-30471329 TTTTTACCACCTTATGGGACAGG No data
904432157_904432166 3 Left 904432157 1:30471281-30471303 CCCATCACAGGCCCTGTCCCTGC No data
Right 904432166 1:30471307-30471329 TTTTTACCACCTTATGGGACAGG No data
904432152_904432166 25 Left 904432152 1:30471259-30471281 CCTCAGAAACTCCCCAGTCACTC No data
Right 904432166 1:30471307-30471329 TTTTTACCACCTTATGGGACAGG No data
904432160_904432166 -9 Left 904432160 1:30471293-30471315 CCTGTCCCTGCTCCTTTTTACCA No data
Right 904432166 1:30471307-30471329 TTTTTACCACCTTATGGGACAGG No data
904432158_904432166 2 Left 904432158 1:30471282-30471304 CCATCACAGGCCCTGTCCCTGCT No data
Right 904432166 1:30471307-30471329 TTTTTACCACCTTATGGGACAGG No data
904432154_904432166 14 Left 904432154 1:30471270-30471292 CCCCAGTCACTCCCATCACAGGC No data
Right 904432166 1:30471307-30471329 TTTTTACCACCTTATGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904432166 Original CRISPR TTTTTACCACCTTATGGGAC AGG Intergenic