ID: 904432170

View in Genome Browser
Species Human (GRCh38)
Location 1:30471317-30471339
Sequence CTTATGGGACAGGCAAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904432158_904432170 12 Left 904432158 1:30471282-30471304 CCATCACAGGCCCTGTCCCTGCT No data
Right 904432170 1:30471317-30471339 CTTATGGGACAGGCAAAAGAGGG No data
904432157_904432170 13 Left 904432157 1:30471281-30471303 CCCATCACAGGCCCTGTCCCTGC No data
Right 904432170 1:30471317-30471339 CTTATGGGACAGGCAAAAGAGGG No data
904432154_904432170 24 Left 904432154 1:30471270-30471292 CCCCAGTCACTCCCATCACAGGC No data
Right 904432170 1:30471317-30471339 CTTATGGGACAGGCAAAAGAGGG No data
904432161_904432170 -4 Left 904432161 1:30471298-30471320 CCCTGCTCCTTTTTACCACCTTA No data
Right 904432170 1:30471317-30471339 CTTATGGGACAGGCAAAAGAGGG No data
904432162_904432170 -5 Left 904432162 1:30471299-30471321 CCTGCTCCTTTTTACCACCTTAT No data
Right 904432170 1:30471317-30471339 CTTATGGGACAGGCAAAAGAGGG No data
904432155_904432170 23 Left 904432155 1:30471271-30471293 CCCAGTCACTCCCATCACAGGCC No data
Right 904432170 1:30471317-30471339 CTTATGGGACAGGCAAAAGAGGG No data
904432160_904432170 1 Left 904432160 1:30471293-30471315 CCTGTCCCTGCTCCTTTTTACCA No data
Right 904432170 1:30471317-30471339 CTTATGGGACAGGCAAAAGAGGG No data
904432156_904432170 22 Left 904432156 1:30471272-30471294 CCAGTCACTCCCATCACAGGCCC No data
Right 904432170 1:30471317-30471339 CTTATGGGACAGGCAAAAGAGGG No data
904432159_904432170 2 Left 904432159 1:30471292-30471314 CCCTGTCCCTGCTCCTTTTTACC No data
Right 904432170 1:30471317-30471339 CTTATGGGACAGGCAAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904432170 Original CRISPR CTTATGGGACAGGCAAAAGA GGG Intergenic