ID: 904432173

View in Genome Browser
Species Human (GRCh38)
Location 1:30471325-30471347
Sequence ACAGGCAAAAGAGGGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904432157_904432173 21 Left 904432157 1:30471281-30471303 CCCATCACAGGCCCTGTCCCTGC No data
Right 904432173 1:30471325-30471347 ACAGGCAAAAGAGGGGAGGCAGG No data
904432156_904432173 30 Left 904432156 1:30471272-30471294 CCAGTCACTCCCATCACAGGCCC No data
Right 904432173 1:30471325-30471347 ACAGGCAAAAGAGGGGAGGCAGG No data
904432162_904432173 3 Left 904432162 1:30471299-30471321 CCTGCTCCTTTTTACCACCTTAT No data
Right 904432173 1:30471325-30471347 ACAGGCAAAAGAGGGGAGGCAGG No data
904432160_904432173 9 Left 904432160 1:30471293-30471315 CCTGTCCCTGCTCCTTTTTACCA No data
Right 904432173 1:30471325-30471347 ACAGGCAAAAGAGGGGAGGCAGG No data
904432159_904432173 10 Left 904432159 1:30471292-30471314 CCCTGTCCCTGCTCCTTTTTACC No data
Right 904432173 1:30471325-30471347 ACAGGCAAAAGAGGGGAGGCAGG No data
904432161_904432173 4 Left 904432161 1:30471298-30471320 CCCTGCTCCTTTTTACCACCTTA No data
Right 904432173 1:30471325-30471347 ACAGGCAAAAGAGGGGAGGCAGG No data
904432165_904432173 -3 Left 904432165 1:30471305-30471327 CCTTTTTACCACCTTATGGGACA No data
Right 904432173 1:30471325-30471347 ACAGGCAAAAGAGGGGAGGCAGG No data
904432158_904432173 20 Left 904432158 1:30471282-30471304 CCATCACAGGCCCTGTCCCTGCT No data
Right 904432173 1:30471325-30471347 ACAGGCAAAAGAGGGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904432173 Original CRISPR ACAGGCAAAAGAGGGGAGGC AGG Intergenic