ID: 904434397

View in Genome Browser
Species Human (GRCh38)
Location 1:30484900-30484922
Sequence GGCCTATGGTCTGGGTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904434388_904434397 12 Left 904434388 1:30484865-30484887 CCAAAGGGGGCCACTGAGGCTCT No data
Right 904434397 1:30484900-30484922 GGCCTATGGTCTGGGTCTCCAGG No data
904434389_904434397 2 Left 904434389 1:30484875-30484897 CCACTGAGGCTCTGCAGACCTCC No data
Right 904434397 1:30484900-30484922 GGCCTATGGTCTGGGTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904434397 Original CRISPR GGCCTATGGTCTGGGTCTCC AGG Intergenic
No off target data available for this crispr