ID: 904435201

View in Genome Browser
Species Human (GRCh38)
Location 1:30490476-30490498
Sequence GGGTGCTGGTGTGGAACAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904435189_904435201 27 Left 904435189 1:30490426-30490448 CCTGACTGCCTCTTCATGAGCCC No data
Right 904435201 1:30490476-30490498 GGGTGCTGGTGTGGAACAGATGG No data
904435192_904435201 7 Left 904435192 1:30490446-30490468 CCCCATCATCAGAGAGGCCTGCA No data
Right 904435201 1:30490476-30490498 GGGTGCTGGTGTGGAACAGATGG No data
904435198_904435201 -10 Left 904435198 1:30490463-30490485 CCTGCAGTCCTGTGGGTGCTGGT No data
Right 904435201 1:30490476-30490498 GGGTGCTGGTGTGGAACAGATGG No data
904435190_904435201 19 Left 904435190 1:30490434-30490456 CCTCTTCATGAGCCCCATCATCA No data
Right 904435201 1:30490476-30490498 GGGTGCTGGTGTGGAACAGATGG No data
904435194_904435201 5 Left 904435194 1:30490448-30490470 CCATCATCAGAGAGGCCTGCAGT No data
Right 904435201 1:30490476-30490498 GGGTGCTGGTGTGGAACAGATGG No data
904435193_904435201 6 Left 904435193 1:30490447-30490469 CCCATCATCAGAGAGGCCTGCAG No data
Right 904435201 1:30490476-30490498 GGGTGCTGGTGTGGAACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904435201 Original CRISPR GGGTGCTGGTGTGGAACAGA TGG Intergenic
No off target data available for this crispr