ID: 904435431

View in Genome Browser
Species Human (GRCh38)
Location 1:30491914-30491936
Sequence CTGGGTCTGGGGAAGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904435431_904435438 24 Left 904435431 1:30491914-30491936 CCAGCTTCCTTCCCCAGACCCAG No data
Right 904435438 1:30491961-30491983 ACAGCCCAATTCCACATTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904435431 Original CRISPR CTGGGTCTGGGGAAGGAAGC TGG (reversed) Intergenic
No off target data available for this crispr