ID: 904437334

View in Genome Browser
Species Human (GRCh38)
Location 1:30507352-30507374
Sequence ACAGCTGCAGATATGCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904437334_904437339 -8 Left 904437334 1:30507352-30507374 CCATGCTGCATATCTGCAGCTGT No data
Right 904437339 1:30507367-30507389 GCAGCTGTCCGGAGGGAGGACGG No data
904437334_904437343 26 Left 904437334 1:30507352-30507374 CCATGCTGCATATCTGCAGCTGT No data
Right 904437343 1:30507401-30507423 ATTTCCACCTCTGAATCTCGAGG No data
904437334_904437340 -2 Left 904437334 1:30507352-30507374 CCATGCTGCATATCTGCAGCTGT No data
Right 904437340 1:30507373-30507395 GTCCGGAGGGAGGACGGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904437334 Original CRISPR ACAGCTGCAGATATGCAGCA TGG (reversed) Intergenic
No off target data available for this crispr