ID: 904437340

View in Genome Browser
Species Human (GRCh38)
Location 1:30507373-30507395
Sequence GTCCGGAGGGAGGACGGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904437334_904437340 -2 Left 904437334 1:30507352-30507374 CCATGCTGCATATCTGCAGCTGT No data
Right 904437340 1:30507373-30507395 GTCCGGAGGGAGGACGGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904437340 Original CRISPR GTCCGGAGGGAGGACGGTGA TGG Intergenic
No off target data available for this crispr