ID: 904441222

View in Genome Browser
Species Human (GRCh38)
Location 1:30533254-30533276
Sequence AGGGGGAACAGATTGGCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904441222_904441229 -3 Left 904441222 1:30533254-30533276 CCATGAGCCAATCTGTTCCCCCT No data
Right 904441229 1:30533274-30533296 CCTTCTGTTGCAGCCATTTTGGG No data
904441222_904441227 -4 Left 904441222 1:30533254-30533276 CCATGAGCCAATCTGTTCCCCCT No data
Right 904441227 1:30533273-30533295 CCCTTCTGTTGCAGCCATTTTGG No data
904441222_904441231 26 Left 904441222 1:30533254-30533276 CCATGAGCCAATCTGTTCCCCCT No data
Right 904441231 1:30533303-30533325 TTCTAACACCTACAGCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904441222 Original CRISPR AGGGGGAACAGATTGGCTCA TGG (reversed) Intergenic
No off target data available for this crispr