ID: 904446385

View in Genome Browser
Species Human (GRCh38)
Location 1:30576291-30576313
Sequence CCTTATCTAGAGAAAAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904446385_904446389 -1 Left 904446385 1:30576291-30576313 CCATCCTTTTTCTCTAGATAAGG No data
Right 904446389 1:30576313-30576335 GGTGAAATCAGTTTTTTTCAAGG No data
904446385_904446390 2 Left 904446385 1:30576291-30576313 CCATCCTTTTTCTCTAGATAAGG No data
Right 904446390 1:30576316-30576338 GAAATCAGTTTTTTTCAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904446385 Original CRISPR CCTTATCTAGAGAAAAAGGA TGG (reversed) Intergenic
No off target data available for this crispr