ID: 904447724

View in Genome Browser
Species Human (GRCh38)
Location 1:30588451-30588473
Sequence GGGTGTTCCCCCATTTGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904447716_904447724 19 Left 904447716 1:30588409-30588431 CCATTTAGGCATCTGCCTCTCCA No data
Right 904447724 1:30588451-30588473 GGGTGTTCCCCCATTTGAGCTGG No data
904447717_904447724 4 Left 904447717 1:30588424-30588446 CCTCTCCATCAGACTGTGAGCCC No data
Right 904447724 1:30588451-30588473 GGGTGTTCCCCCATTTGAGCTGG No data
904447718_904447724 -1 Left 904447718 1:30588429-30588451 CCATCAGACTGTGAGCCCCTGAG No data
Right 904447724 1:30588451-30588473 GGGTGTTCCCCCATTTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904447724 Original CRISPR GGGTGTTCCCCCATTTGAGC TGG Intergenic
No off target data available for this crispr