ID: 904447912

View in Genome Browser
Species Human (GRCh38)
Location 1:30589384-30589406
Sequence AAACCAAGGCCTGGGAAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904447912_904447920 2 Left 904447912 1:30589384-30589406 CCAACCTTCCCAGGCCTTGGTTT No data
Right 904447920 1:30589409-30589431 CCTGTGAGTCACTGAGTTTTGGG No data
904447912_904447918 1 Left 904447912 1:30589384-30589406 CCAACCTTCCCAGGCCTTGGTTT No data
Right 904447918 1:30589408-30589430 CCCTGTGAGTCACTGAGTTTTGG No data
904447912_904447921 14 Left 904447912 1:30589384-30589406 CCAACCTTCCCAGGCCTTGGTTT No data
Right 904447921 1:30589421-30589443 TGAGTTTTGGGCATCACATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904447912 Original CRISPR AAACCAAGGCCTGGGAAGGT TGG (reversed) Intergenic
No off target data available for this crispr