ID: 904454088

View in Genome Browser
Species Human (GRCh38)
Location 1:30636515-30636537
Sequence TGCTCTGCTCTGAAGGCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904454088_904454096 14 Left 904454088 1:30636515-30636537 CCCCAGGCCTTCAGAGCAGAGCA No data
Right 904454096 1:30636552-30636574 CTGAGTCTCACCAAGGTATGAGG No data
904454088_904454099 25 Left 904454088 1:30636515-30636537 CCCCAGGCCTTCAGAGCAGAGCA No data
Right 904454099 1:30636563-30636585 CAAGGTATGAGGGCTGCTGCAGG No data
904454088_904454097 15 Left 904454088 1:30636515-30636537 CCCCAGGCCTTCAGAGCAGAGCA No data
Right 904454097 1:30636553-30636575 TGAGTCTCACCAAGGTATGAGGG No data
904454088_904454100 26 Left 904454088 1:30636515-30636537 CCCCAGGCCTTCAGAGCAGAGCA No data
Right 904454100 1:30636564-30636586 AAGGTATGAGGGCTGCTGCAGGG No data
904454088_904454092 7 Left 904454088 1:30636515-30636537 CCCCAGGCCTTCAGAGCAGAGCA No data
Right 904454092 1:30636545-30636567 CTCCACCCTGAGTCTCACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904454088 Original CRISPR TGCTCTGCTCTGAAGGCCTG GGG (reversed) Intergenic
No off target data available for this crispr