ID: 904454091

View in Genome Browser
Species Human (GRCh38)
Location 1:30636522-30636544
Sequence CTATCTCTGCTCTGCTCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904454091_904454101 26 Left 904454091 1:30636522-30636544 CCTTCAGAGCAGAGCAGAGATAG No data
Right 904454101 1:30636571-30636593 GAGGGCTGCTGCAGGGAGAGTGG No data
904454091_904454100 19 Left 904454091 1:30636522-30636544 CCTTCAGAGCAGAGCAGAGATAG No data
Right 904454100 1:30636564-30636586 AAGGTATGAGGGCTGCTGCAGGG No data
904454091_904454099 18 Left 904454091 1:30636522-30636544 CCTTCAGAGCAGAGCAGAGATAG No data
Right 904454099 1:30636563-30636585 CAAGGTATGAGGGCTGCTGCAGG No data
904454091_904454102 27 Left 904454091 1:30636522-30636544 CCTTCAGAGCAGAGCAGAGATAG No data
Right 904454102 1:30636572-30636594 AGGGCTGCTGCAGGGAGAGTGGG No data
904454091_904454092 0 Left 904454091 1:30636522-30636544 CCTTCAGAGCAGAGCAGAGATAG No data
Right 904454092 1:30636545-30636567 CTCCACCCTGAGTCTCACCAAGG No data
904454091_904454096 7 Left 904454091 1:30636522-30636544 CCTTCAGAGCAGAGCAGAGATAG No data
Right 904454096 1:30636552-30636574 CTGAGTCTCACCAAGGTATGAGG No data
904454091_904454103 30 Left 904454091 1:30636522-30636544 CCTTCAGAGCAGAGCAGAGATAG No data
Right 904454103 1:30636575-30636597 GCTGCTGCAGGGAGAGTGGGTGG No data
904454091_904454097 8 Left 904454091 1:30636522-30636544 CCTTCAGAGCAGAGCAGAGATAG No data
Right 904454097 1:30636553-30636575 TGAGTCTCACCAAGGTATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904454091 Original CRISPR CTATCTCTGCTCTGCTCTGA AGG (reversed) Intergenic
No off target data available for this crispr