ID: 904454092

View in Genome Browser
Species Human (GRCh38)
Location 1:30636545-30636567
Sequence CTCCACCCTGAGTCTCACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904454089_904454092 6 Left 904454089 1:30636516-30636538 CCCAGGCCTTCAGAGCAGAGCAG No data
Right 904454092 1:30636545-30636567 CTCCACCCTGAGTCTCACCAAGG No data
904454084_904454092 24 Left 904454084 1:30636498-30636520 CCCCAGTGAGGCAGGAGCCCCAG No data
Right 904454092 1:30636545-30636567 CTCCACCCTGAGTCTCACCAAGG No data
904454091_904454092 0 Left 904454091 1:30636522-30636544 CCTTCAGAGCAGAGCAGAGATAG No data
Right 904454092 1:30636545-30636567 CTCCACCCTGAGTCTCACCAAGG No data
904454088_904454092 7 Left 904454088 1:30636515-30636537 CCCCAGGCCTTCAGAGCAGAGCA No data
Right 904454092 1:30636545-30636567 CTCCACCCTGAGTCTCACCAAGG No data
904454087_904454092 22 Left 904454087 1:30636500-30636522 CCAGTGAGGCAGGAGCCCCAGGC No data
Right 904454092 1:30636545-30636567 CTCCACCCTGAGTCTCACCAAGG No data
904454085_904454092 23 Left 904454085 1:30636499-30636521 CCCAGTGAGGCAGGAGCCCCAGG No data
Right 904454092 1:30636545-30636567 CTCCACCCTGAGTCTCACCAAGG No data
904454090_904454092 5 Left 904454090 1:30636517-30636539 CCAGGCCTTCAGAGCAGAGCAGA No data
Right 904454092 1:30636545-30636567 CTCCACCCTGAGTCTCACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904454092 Original CRISPR CTCCACCCTGAGTCTCACCA AGG Intergenic
No off target data available for this crispr