ID: 904454093

View in Genome Browser
Species Human (GRCh38)
Location 1:30636547-30636569
Sequence TACCTTGGTGAGACTCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904454093_904454109 23 Left 904454093 1:30636547-30636569 CCACCCTGAGTCTCACCAAGGTA No data
Right 904454109 1:30636593-30636615 GGTGGAGCCGGGACAGGGGCAGG No data
904454093_904454104 11 Left 904454093 1:30636547-30636569 CCACCCTGAGTCTCACCAAGGTA No data
Right 904454104 1:30636581-30636603 GCAGGGAGAGTGGGTGGAGCCGG No data
904454093_904454099 -7 Left 904454093 1:30636547-30636569 CCACCCTGAGTCTCACCAAGGTA No data
Right 904454099 1:30636563-30636585 CAAGGTATGAGGGCTGCTGCAGG No data
904454093_904454102 2 Left 904454093 1:30636547-30636569 CCACCCTGAGTCTCACCAAGGTA No data
Right 904454102 1:30636572-30636594 AGGGCTGCTGCAGGGAGAGTGGG No data
904454093_904454105 12 Left 904454093 1:30636547-30636569 CCACCCTGAGTCTCACCAAGGTA No data
Right 904454105 1:30636582-30636604 CAGGGAGAGTGGGTGGAGCCGGG No data
904454093_904454100 -6 Left 904454093 1:30636547-30636569 CCACCCTGAGTCTCACCAAGGTA No data
Right 904454100 1:30636564-30636586 AAGGTATGAGGGCTGCTGCAGGG No data
904454093_904454107 18 Left 904454093 1:30636547-30636569 CCACCCTGAGTCTCACCAAGGTA No data
Right 904454107 1:30636588-30636610 GAGTGGGTGGAGCCGGGACAGGG No data
904454093_904454101 1 Left 904454093 1:30636547-30636569 CCACCCTGAGTCTCACCAAGGTA No data
Right 904454101 1:30636571-30636593 GAGGGCTGCTGCAGGGAGAGTGG No data
904454093_904454103 5 Left 904454093 1:30636547-30636569 CCACCCTGAGTCTCACCAAGGTA No data
Right 904454103 1:30636575-30636597 GCTGCTGCAGGGAGAGTGGGTGG No data
904454093_904454108 19 Left 904454093 1:30636547-30636569 CCACCCTGAGTCTCACCAAGGTA No data
Right 904454108 1:30636589-30636611 AGTGGGTGGAGCCGGGACAGGGG No data
904454093_904454106 17 Left 904454093 1:30636547-30636569 CCACCCTGAGTCTCACCAAGGTA No data
Right 904454106 1:30636587-30636609 AGAGTGGGTGGAGCCGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904454093 Original CRISPR TACCTTGGTGAGACTCAGGG TGG (reversed) Intergenic
No off target data available for this crispr