ID: 904454094

View in Genome Browser
Species Human (GRCh38)
Location 1:30636550-30636572
Sequence TCATACCTTGGTGAGACTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904454094_904454103 2 Left 904454094 1:30636550-30636572 CCCTGAGTCTCACCAAGGTATGA No data
Right 904454103 1:30636575-30636597 GCTGCTGCAGGGAGAGTGGGTGG No data
904454094_904454102 -1 Left 904454094 1:30636550-30636572 CCCTGAGTCTCACCAAGGTATGA No data
Right 904454102 1:30636572-30636594 AGGGCTGCTGCAGGGAGAGTGGG No data
904454094_904454107 15 Left 904454094 1:30636550-30636572 CCCTGAGTCTCACCAAGGTATGA No data
Right 904454107 1:30636588-30636610 GAGTGGGTGGAGCCGGGACAGGG No data
904454094_904454109 20 Left 904454094 1:30636550-30636572 CCCTGAGTCTCACCAAGGTATGA No data
Right 904454109 1:30636593-30636615 GGTGGAGCCGGGACAGGGGCAGG No data
904454094_904454104 8 Left 904454094 1:30636550-30636572 CCCTGAGTCTCACCAAGGTATGA No data
Right 904454104 1:30636581-30636603 GCAGGGAGAGTGGGTGGAGCCGG No data
904454094_904454106 14 Left 904454094 1:30636550-30636572 CCCTGAGTCTCACCAAGGTATGA No data
Right 904454106 1:30636587-30636609 AGAGTGGGTGGAGCCGGGACAGG No data
904454094_904454101 -2 Left 904454094 1:30636550-30636572 CCCTGAGTCTCACCAAGGTATGA No data
Right 904454101 1:30636571-30636593 GAGGGCTGCTGCAGGGAGAGTGG No data
904454094_904454100 -9 Left 904454094 1:30636550-30636572 CCCTGAGTCTCACCAAGGTATGA No data
Right 904454100 1:30636564-30636586 AAGGTATGAGGGCTGCTGCAGGG No data
904454094_904454105 9 Left 904454094 1:30636550-30636572 CCCTGAGTCTCACCAAGGTATGA No data
Right 904454105 1:30636582-30636604 CAGGGAGAGTGGGTGGAGCCGGG No data
904454094_904454099 -10 Left 904454094 1:30636550-30636572 CCCTGAGTCTCACCAAGGTATGA No data
Right 904454099 1:30636563-30636585 CAAGGTATGAGGGCTGCTGCAGG No data
904454094_904454108 16 Left 904454094 1:30636550-30636572 CCCTGAGTCTCACCAAGGTATGA No data
Right 904454108 1:30636589-30636611 AGTGGGTGGAGCCGGGACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904454094 Original CRISPR TCATACCTTGGTGAGACTCA GGG (reversed) Intergenic
No off target data available for this crispr