ID: 904454096

View in Genome Browser
Species Human (GRCh38)
Location 1:30636552-30636574
Sequence CTGAGTCTCACCAAGGTATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904454090_904454096 12 Left 904454090 1:30636517-30636539 CCAGGCCTTCAGAGCAGAGCAGA No data
Right 904454096 1:30636552-30636574 CTGAGTCTCACCAAGGTATGAGG No data
904454091_904454096 7 Left 904454091 1:30636522-30636544 CCTTCAGAGCAGAGCAGAGATAG No data
Right 904454096 1:30636552-30636574 CTGAGTCTCACCAAGGTATGAGG No data
904454088_904454096 14 Left 904454088 1:30636515-30636537 CCCCAGGCCTTCAGAGCAGAGCA No data
Right 904454096 1:30636552-30636574 CTGAGTCTCACCAAGGTATGAGG No data
904454087_904454096 29 Left 904454087 1:30636500-30636522 CCAGTGAGGCAGGAGCCCCAGGC No data
Right 904454096 1:30636552-30636574 CTGAGTCTCACCAAGGTATGAGG No data
904454085_904454096 30 Left 904454085 1:30636499-30636521 CCCAGTGAGGCAGGAGCCCCAGG No data
Right 904454096 1:30636552-30636574 CTGAGTCTCACCAAGGTATGAGG No data
904454089_904454096 13 Left 904454089 1:30636516-30636538 CCCAGGCCTTCAGAGCAGAGCAG No data
Right 904454096 1:30636552-30636574 CTGAGTCTCACCAAGGTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904454096 Original CRISPR CTGAGTCTCACCAAGGTATG AGG Intergenic
No off target data available for this crispr