ID: 904454097

View in Genome Browser
Species Human (GRCh38)
Location 1:30636553-30636575
Sequence TGAGTCTCACCAAGGTATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904454090_904454097 13 Left 904454090 1:30636517-30636539 CCAGGCCTTCAGAGCAGAGCAGA No data
Right 904454097 1:30636553-30636575 TGAGTCTCACCAAGGTATGAGGG No data
904454087_904454097 30 Left 904454087 1:30636500-30636522 CCAGTGAGGCAGGAGCCCCAGGC No data
Right 904454097 1:30636553-30636575 TGAGTCTCACCAAGGTATGAGGG No data
904454091_904454097 8 Left 904454091 1:30636522-30636544 CCTTCAGAGCAGAGCAGAGATAG No data
Right 904454097 1:30636553-30636575 TGAGTCTCACCAAGGTATGAGGG No data
904454088_904454097 15 Left 904454088 1:30636515-30636537 CCCCAGGCCTTCAGAGCAGAGCA No data
Right 904454097 1:30636553-30636575 TGAGTCTCACCAAGGTATGAGGG No data
904454089_904454097 14 Left 904454089 1:30636516-30636538 CCCAGGCCTTCAGAGCAGAGCAG No data
Right 904454097 1:30636553-30636575 TGAGTCTCACCAAGGTATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904454097 Original CRISPR TGAGTCTCACCAAGGTATGA GGG Intergenic
No off target data available for this crispr