ID: 904454099

View in Genome Browser
Species Human (GRCh38)
Location 1:30636563-30636585
Sequence CAAGGTATGAGGGCTGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904454090_904454099 23 Left 904454090 1:30636517-30636539 CCAGGCCTTCAGAGCAGAGCAGA No data
Right 904454099 1:30636563-30636585 CAAGGTATGAGGGCTGCTGCAGG No data
904454089_904454099 24 Left 904454089 1:30636516-30636538 CCCAGGCCTTCAGAGCAGAGCAG No data
Right 904454099 1:30636563-30636585 CAAGGTATGAGGGCTGCTGCAGG No data
904454093_904454099 -7 Left 904454093 1:30636547-30636569 CCACCCTGAGTCTCACCAAGGTA No data
Right 904454099 1:30636563-30636585 CAAGGTATGAGGGCTGCTGCAGG No data
904454091_904454099 18 Left 904454091 1:30636522-30636544 CCTTCAGAGCAGAGCAGAGATAG No data
Right 904454099 1:30636563-30636585 CAAGGTATGAGGGCTGCTGCAGG No data
904454088_904454099 25 Left 904454088 1:30636515-30636537 CCCCAGGCCTTCAGAGCAGAGCA No data
Right 904454099 1:30636563-30636585 CAAGGTATGAGGGCTGCTGCAGG No data
904454094_904454099 -10 Left 904454094 1:30636550-30636572 CCCTGAGTCTCACCAAGGTATGA No data
Right 904454099 1:30636563-30636585 CAAGGTATGAGGGCTGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904454099 Original CRISPR CAAGGTATGAGGGCTGCTGC AGG Intergenic
No off target data available for this crispr