ID: 904454100

View in Genome Browser
Species Human (GRCh38)
Location 1:30636564-30636586
Sequence AAGGTATGAGGGCTGCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904454088_904454100 26 Left 904454088 1:30636515-30636537 CCCCAGGCCTTCAGAGCAGAGCA No data
Right 904454100 1:30636564-30636586 AAGGTATGAGGGCTGCTGCAGGG No data
904454091_904454100 19 Left 904454091 1:30636522-30636544 CCTTCAGAGCAGAGCAGAGATAG No data
Right 904454100 1:30636564-30636586 AAGGTATGAGGGCTGCTGCAGGG No data
904454094_904454100 -9 Left 904454094 1:30636550-30636572 CCCTGAGTCTCACCAAGGTATGA No data
Right 904454100 1:30636564-30636586 AAGGTATGAGGGCTGCTGCAGGG No data
904454090_904454100 24 Left 904454090 1:30636517-30636539 CCAGGCCTTCAGAGCAGAGCAGA No data
Right 904454100 1:30636564-30636586 AAGGTATGAGGGCTGCTGCAGGG No data
904454093_904454100 -6 Left 904454093 1:30636547-30636569 CCACCCTGAGTCTCACCAAGGTA No data
Right 904454100 1:30636564-30636586 AAGGTATGAGGGCTGCTGCAGGG No data
904454089_904454100 25 Left 904454089 1:30636516-30636538 CCCAGGCCTTCAGAGCAGAGCAG No data
Right 904454100 1:30636564-30636586 AAGGTATGAGGGCTGCTGCAGGG No data
904454095_904454100 -10 Left 904454095 1:30636551-30636573 CCTGAGTCTCACCAAGGTATGAG No data
Right 904454100 1:30636564-30636586 AAGGTATGAGGGCTGCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904454100 Original CRISPR AAGGTATGAGGGCTGCTGCA GGG Intergenic
No off target data available for this crispr