ID: 904454101

View in Genome Browser
Species Human (GRCh38)
Location 1:30636571-30636593
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904454093_904454101 1 Left 904454093 1:30636547-30636569 CCACCCTGAGTCTCACCAAGGTA No data
Right 904454101 1:30636571-30636593 GAGGGCTGCTGCAGGGAGAGTGG No data
904454095_904454101 -3 Left 904454095 1:30636551-30636573 CCTGAGTCTCACCAAGGTATGAG No data
Right 904454101 1:30636571-30636593 GAGGGCTGCTGCAGGGAGAGTGG No data
904454091_904454101 26 Left 904454091 1:30636522-30636544 CCTTCAGAGCAGAGCAGAGATAG No data
Right 904454101 1:30636571-30636593 GAGGGCTGCTGCAGGGAGAGTGG No data
904454094_904454101 -2 Left 904454094 1:30636550-30636572 CCCTGAGTCTCACCAAGGTATGA No data
Right 904454101 1:30636571-30636593 GAGGGCTGCTGCAGGGAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr