ID: 904454108

View in Genome Browser
Species Human (GRCh38)
Location 1:30636589-30636611
Sequence AGTGGGTGGAGCCGGGACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904454094_904454108 16 Left 904454094 1:30636550-30636572 CCCTGAGTCTCACCAAGGTATGA No data
Right 904454108 1:30636589-30636611 AGTGGGTGGAGCCGGGACAGGGG No data
904454093_904454108 19 Left 904454093 1:30636547-30636569 CCACCCTGAGTCTCACCAAGGTA No data
Right 904454108 1:30636589-30636611 AGTGGGTGGAGCCGGGACAGGGG No data
904454095_904454108 15 Left 904454095 1:30636551-30636573 CCTGAGTCTCACCAAGGTATGAG No data
Right 904454108 1:30636589-30636611 AGTGGGTGGAGCCGGGACAGGGG No data
904454098_904454108 4 Left 904454098 1:30636562-30636584 CCAAGGTATGAGGGCTGCTGCAG No data
Right 904454108 1:30636589-30636611 AGTGGGTGGAGCCGGGACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904454108 Original CRISPR AGTGGGTGGAGCCGGGACAG GGG Intergenic
No off target data available for this crispr