ID: 904454109

View in Genome Browser
Species Human (GRCh38)
Location 1:30636593-30636615
Sequence GGTGGAGCCGGGACAGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904454098_904454109 8 Left 904454098 1:30636562-30636584 CCAAGGTATGAGGGCTGCTGCAG No data
Right 904454109 1:30636593-30636615 GGTGGAGCCGGGACAGGGGCAGG No data
904454093_904454109 23 Left 904454093 1:30636547-30636569 CCACCCTGAGTCTCACCAAGGTA No data
Right 904454109 1:30636593-30636615 GGTGGAGCCGGGACAGGGGCAGG No data
904454094_904454109 20 Left 904454094 1:30636550-30636572 CCCTGAGTCTCACCAAGGTATGA No data
Right 904454109 1:30636593-30636615 GGTGGAGCCGGGACAGGGGCAGG No data
904454095_904454109 19 Left 904454095 1:30636551-30636573 CCTGAGTCTCACCAAGGTATGAG No data
Right 904454109 1:30636593-30636615 GGTGGAGCCGGGACAGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904454109 Original CRISPR GGTGGAGCCGGGACAGGGGC AGG Intergenic
No off target data available for this crispr