ID: 904456895

View in Genome Browser
Species Human (GRCh38)
Location 1:30653318-30653340
Sequence GACCTGTCCTGACACTCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904456895_904456900 25 Left 904456895 1:30653318-30653340 CCAGTTGAGTGTCAGGACAGGTC No data
Right 904456900 1:30653366-30653388 TCACTGATGCTCACTGAGCTGGG No data
904456895_904456897 -4 Left 904456895 1:30653318-30653340 CCAGTTGAGTGTCAGGACAGGTC No data
Right 904456897 1:30653337-30653359 GGTCAGAACTTCCAAGGCTGTGG No data
904456895_904456899 24 Left 904456895 1:30653318-30653340 CCAGTTGAGTGTCAGGACAGGTC No data
Right 904456899 1:30653365-30653387 ATCACTGATGCTCACTGAGCTGG No data
904456895_904456896 -10 Left 904456895 1:30653318-30653340 CCAGTTGAGTGTCAGGACAGGTC No data
Right 904456896 1:30653331-30653353 AGGACAGGTCAGAACTTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904456895 Original CRISPR GACCTGTCCTGACACTCAAC TGG (reversed) Intergenic
No off target data available for this crispr