ID: 904459124 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:30664983-30665005 |
| Sequence | CAAGGTCATCTTGGGGAGAA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 904459116_904459124 | 9 | Left | 904459116 | 1:30664951-30664973 | CCAGTTCCTGGCACACTTGGTTA | No data | ||
| Right | 904459124 | 1:30664983-30665005 | CAAGGTCATCTTGGGGAGAAGGG | No data | ||||
| 904459117_904459124 | 3 | Left | 904459117 | 1:30664957-30664979 | CCTGGCACACTTGGTTACGCACC | No data | ||
| Right | 904459124 | 1:30664983-30665005 | CAAGGTCATCTTGGGGAGAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 904459124 | Original CRISPR | CAAGGTCATCTTGGGGAGAA GGG | Intergenic | ||
| No off target data available for this crispr | |||||