ID: 904459124

View in Genome Browser
Species Human (GRCh38)
Location 1:30664983-30665005
Sequence CAAGGTCATCTTGGGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904459116_904459124 9 Left 904459116 1:30664951-30664973 CCAGTTCCTGGCACACTTGGTTA No data
Right 904459124 1:30664983-30665005 CAAGGTCATCTTGGGGAGAAGGG No data
904459117_904459124 3 Left 904459117 1:30664957-30664979 CCTGGCACACTTGGTTACGCACC No data
Right 904459124 1:30664983-30665005 CAAGGTCATCTTGGGGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904459124 Original CRISPR CAAGGTCATCTTGGGGAGAA GGG Intergenic
No off target data available for this crispr