ID: 904459363

View in Genome Browser
Species Human (GRCh38)
Location 1:30666479-30666501
Sequence ATCCCTGGGGCTTGTATCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904459363_904459374 18 Left 904459363 1:30666479-30666501 CCCTGGATACAAGCCCCAGGGAT No data
Right 904459374 1:30666520-30666542 GTCCCCCAGCTCGGAGAAGGTGG No data
904459363_904459371 9 Left 904459363 1:30666479-30666501 CCCTGGATACAAGCCCCAGGGAT No data
Right 904459371 1:30666511-30666533 AAGCAGCCAGTCCCCCAGCTCGG No data
904459363_904459377 20 Left 904459363 1:30666479-30666501 CCCTGGATACAAGCCCCAGGGAT No data
Right 904459377 1:30666522-30666544 CCCCCAGCTCGGAGAAGGTGGGG No data
904459363_904459375 19 Left 904459363 1:30666479-30666501 CCCTGGATACAAGCCCCAGGGAT No data
Right 904459375 1:30666521-30666543 TCCCCCAGCTCGGAGAAGGTGGG No data
904459363_904459381 22 Left 904459363 1:30666479-30666501 CCCTGGATACAAGCCCCAGGGAT No data
Right 904459381 1:30666524-30666546 CCCAGCTCGGAGAAGGTGGGGGG No data
904459363_904459373 15 Left 904459363 1:30666479-30666501 CCCTGGATACAAGCCCCAGGGAT No data
Right 904459373 1:30666517-30666539 CCAGTCCCCCAGCTCGGAGAAGG No data
904459363_904459379 21 Left 904459363 1:30666479-30666501 CCCTGGATACAAGCCCCAGGGAT No data
Right 904459379 1:30666523-30666545 CCCCAGCTCGGAGAAGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904459363 Original CRISPR ATCCCTGGGGCTTGTATCCA GGG (reversed) Intergenic
No off target data available for this crispr