ID: 904459369

View in Genome Browser
Species Human (GRCh38)
Location 1:30666493-30666515
Sequence TGCTTAGCTTCCCCATCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904459369_904459385 29 Left 904459369 1:30666493-30666515 CCCAGGGATGGGGAAGCTAAGCA No data
Right 904459385 1:30666545-30666567 GGAACAGAGCCCAGGAGAATGGG No data
904459369_904459373 1 Left 904459369 1:30666493-30666515 CCCAGGGATGGGGAAGCTAAGCA No data
Right 904459373 1:30666517-30666539 CCAGTCCCCCAGCTCGGAGAAGG No data
904459369_904459375 5 Left 904459369 1:30666493-30666515 CCCAGGGATGGGGAAGCTAAGCA No data
Right 904459375 1:30666521-30666543 TCCCCCAGCTCGGAGAAGGTGGG No data
904459369_904459383 21 Left 904459369 1:30666493-30666515 CCCAGGGATGGGGAAGCTAAGCA No data
Right 904459383 1:30666537-30666559 AGGTGGGGGGAACAGAGCCCAGG No data
904459369_904459374 4 Left 904459369 1:30666493-30666515 CCCAGGGATGGGGAAGCTAAGCA No data
Right 904459374 1:30666520-30666542 GTCCCCCAGCTCGGAGAAGGTGG No data
904459369_904459384 28 Left 904459369 1:30666493-30666515 CCCAGGGATGGGGAAGCTAAGCA No data
Right 904459384 1:30666544-30666566 GGGAACAGAGCCCAGGAGAATGG No data
904459369_904459377 6 Left 904459369 1:30666493-30666515 CCCAGGGATGGGGAAGCTAAGCA No data
Right 904459377 1:30666522-30666544 CCCCCAGCTCGGAGAAGGTGGGG No data
904459369_904459381 8 Left 904459369 1:30666493-30666515 CCCAGGGATGGGGAAGCTAAGCA No data
Right 904459381 1:30666524-30666546 CCCAGCTCGGAGAAGGTGGGGGG No data
904459369_904459379 7 Left 904459369 1:30666493-30666515 CCCAGGGATGGGGAAGCTAAGCA No data
Right 904459379 1:30666523-30666545 CCCCAGCTCGGAGAAGGTGGGGG No data
904459369_904459371 -5 Left 904459369 1:30666493-30666515 CCCAGGGATGGGGAAGCTAAGCA No data
Right 904459371 1:30666511-30666533 AAGCAGCCAGTCCCCCAGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904459369 Original CRISPR TGCTTAGCTTCCCCATCCCT GGG (reversed) Intergenic
No off target data available for this crispr