ID: 904459381

View in Genome Browser
Species Human (GRCh38)
Location 1:30666524-30666546
Sequence CCCAGCTCGGAGAAGGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904459369_904459381 8 Left 904459369 1:30666493-30666515 CCCAGGGATGGGGAAGCTAAGCA No data
Right 904459381 1:30666524-30666546 CCCAGCTCGGAGAAGGTGGGGGG No data
904459368_904459381 9 Left 904459368 1:30666492-30666514 CCCCAGGGATGGGGAAGCTAAGC No data
Right 904459381 1:30666524-30666546 CCCAGCTCGGAGAAGGTGGGGGG No data
904459370_904459381 7 Left 904459370 1:30666494-30666516 CCAGGGATGGGGAAGCTAAGCAG No data
Right 904459381 1:30666524-30666546 CCCAGCTCGGAGAAGGTGGGGGG No data
904459363_904459381 22 Left 904459363 1:30666479-30666501 CCCTGGATACAAGCCCCAGGGAT No data
Right 904459381 1:30666524-30666546 CCCAGCTCGGAGAAGGTGGGGGG No data
904459364_904459381 21 Left 904459364 1:30666480-30666502 CCTGGATACAAGCCCCAGGGATG No data
Right 904459381 1:30666524-30666546 CCCAGCTCGGAGAAGGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904459381 Original CRISPR CCCAGCTCGGAGAAGGTGGG GGG Intergenic
No off target data available for this crispr