ID: 904461331

View in Genome Browser
Species Human (GRCh38)
Location 1:30682105-30682127
Sequence GAACCAGCTGGGTGGCCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904461323_904461331 -2 Left 904461323 1:30682084-30682106 CCAGGTTCAGTCCCTGCTCTGGA No data
Right 904461331 1:30682105-30682127 GAACCAGCTGGGTGGCCTTGGGG No data
904461320_904461331 16 Left 904461320 1:30682066-30682088 CCTTGAAGACTCACAGAGCCAGG No data
Right 904461331 1:30682105-30682127 GAACCAGCTGGGTGGCCTTGGGG No data
904461319_904461331 17 Left 904461319 1:30682065-30682087 CCCTTGAAGACTCACAGAGCCAG No data
Right 904461331 1:30682105-30682127 GAACCAGCTGGGTGGCCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904461331 Original CRISPR GAACCAGCTGGGTGGCCTTG GGG Intergenic
No off target data available for this crispr