ID: 904462668

View in Genome Browser
Species Human (GRCh38)
Location 1:30689441-30689463
Sequence CTCGGGTGCACCTCGGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904462656_904462668 22 Left 904462656 1:30689396-30689418 CCCCAGGGACTCCCAGCTGGGGA No data
Right 904462668 1:30689441-30689463 CTCGGGTGCACCTCGGGTGCAGG No data
904462657_904462668 21 Left 904462657 1:30689397-30689419 CCCAGGGACTCCCAGCTGGGGAC No data
Right 904462668 1:30689441-30689463 CTCGGGTGCACCTCGGGTGCAGG No data
904462659_904462668 11 Left 904462659 1:30689407-30689429 CCCAGCTGGGGACTTTGCAAGAA No data
Right 904462668 1:30689441-30689463 CTCGGGTGCACCTCGGGTGCAGG No data
904462658_904462668 20 Left 904462658 1:30689398-30689420 CCAGGGACTCCCAGCTGGGGACT No data
Right 904462668 1:30689441-30689463 CTCGGGTGCACCTCGGGTGCAGG No data
904462660_904462668 10 Left 904462660 1:30689408-30689430 CCAGCTGGGGACTTTGCAAGAAA No data
Right 904462668 1:30689441-30689463 CTCGGGTGCACCTCGGGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904462668 Original CRISPR CTCGGGTGCACCTCGGGTGC AGG Intergenic
No off target data available for this crispr