ID: 904463947

View in Genome Browser
Species Human (GRCh38)
Location 1:30697040-30697062
Sequence TTGGGGCCCCGGGAGGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904463947_904463962 19 Left 904463947 1:30697040-30697062 CCTCCATCCTCCCGGGGCCCCAA No data
Right 904463962 1:30697082-30697104 GGCCGCATCGCTGCTGCCACTGG No data
904463947_904463958 -3 Left 904463947 1:30697040-30697062 CCTCCATCCTCCCGGGGCCCCAA No data
Right 904463958 1:30697060-30697082 CAAACCCAGGGTGGTGAGTAAGG No data
904463947_904463959 -2 Left 904463947 1:30697040-30697062 CCTCCATCCTCCCGGGGCCCCAA No data
Right 904463959 1:30697061-30697083 AAACCCAGGGTGGTGAGTAAGGG No data
904463947_904463963 20 Left 904463947 1:30697040-30697062 CCTCCATCCTCCCGGGGCCCCAA No data
Right 904463963 1:30697083-30697105 GCCGCATCGCTGCTGCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904463947 Original CRISPR TTGGGGCCCCGGGAGGATGG AGG (reversed) Intergenic
No off target data available for this crispr