ID: 904465973

View in Genome Browser
Species Human (GRCh38)
Location 1:30707745-30707767
Sequence GCTTTGGATGGCAGAGTCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904465962_904465973 22 Left 904465962 1:30707700-30707722 CCACGGCCATAGGGCACACCAGG No data
Right 904465973 1:30707745-30707767 GCTTTGGATGGCAGAGTCCGTGG No data
904465966_904465973 4 Left 904465966 1:30707718-30707740 CCAGGGACAGAGCCTATTCACGC No data
Right 904465973 1:30707745-30707767 GCTTTGGATGGCAGAGTCCGTGG No data
904465965_904465973 16 Left 904465965 1:30707706-30707728 CCATAGGGCACACCAGGGACAGA No data
Right 904465973 1:30707745-30707767 GCTTTGGATGGCAGAGTCCGTGG No data
904465970_904465973 -8 Left 904465970 1:30707730-30707752 CCTATTCACGCCAGGGCTTTGGA No data
Right 904465973 1:30707745-30707767 GCTTTGGATGGCAGAGTCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904465973 Original CRISPR GCTTTGGATGGCAGAGTCCG TGG Intergenic
No off target data available for this crispr