ID: 904473197

View in Genome Browser
Species Human (GRCh38)
Location 1:30748421-30748443
Sequence GGCCATAATAATAATGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 380}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904473197_904473208 30 Left 904473197 1:30748421-30748443 CCATCATCATTATTATTATGGCC 0: 1
1: 0
2: 1
3: 35
4: 380
Right 904473208 1:30748474-30748496 CCTGCCCACCCTGATTTCCCTGG 0: 1
1: 0
2: 3
3: 28
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904473197 Original CRISPR GGCCATAATAATAATGATGA TGG (reversed) Intronic
900958279 1:5901982-5902004 GGCCATAAACGTAATGATGAAGG + Intronic
901148028 1:7081219-7081241 GATTATAATAATAATGATGATGG + Intronic
903595598 1:24491632-24491654 GGCCATAATCAGAAGGAAGAAGG - Intergenic
903610402 1:24607307-24607329 GCCTATAATAATAATAATGTTGG - Exonic
904379769 1:30102787-30102809 GACGATGATAATGATGATGATGG + Intergenic
904413331 1:30338697-30338719 GGTGATGATAATGATGATGATGG + Intergenic
904473197 1:30748421-30748443 GGCCATAATAATAATGATGATGG - Intronic
904716508 1:32471684-32471706 GGTGATAATGATCATGATGATGG - Intronic
904915990 1:33971071-33971093 TGCCATAATGATAATGATAATGG - Intronic
905358614 1:37402709-37402731 GTCAATAATAATAATAATAATGG + Intergenic
906388876 1:45396459-45396481 GGCAACGATGATAATGATGATGG + Intronic
907329597 1:53662446-53662468 TGCCATTATCATGATGATGATGG + Intronic
907779332 1:57551398-57551420 GTGCATGATAATAATGATGATGG + Intronic
908279323 1:62514647-62514669 AATAATAATAATAATGATGATGG + Intronic
909378190 1:74964891-74964913 GCCCTTCCTAATAATGATGATGG + Intergenic
909951865 1:81729802-81729824 GGCCAGAATGATATTAATGATGG - Intronic
911053203 1:93689578-93689600 GCCCATAAAAATAAAGAAGAGGG + Intronic
912708878 1:111935586-111935608 GGCAACAATAATGATAATGATGG + Intronic
916361721 1:163977449-163977471 GGTCAGTATAATAATGATGATGG - Intergenic
918613140 1:186514430-186514452 GGCCATAAGAAGGATGTTGAAGG - Intergenic
919230412 1:194765774-194765796 GAACATAATATTAAGGATGAAGG - Intergenic
919556429 1:199060216-199060238 GCTCTTAATAATAATGATGATGG + Intergenic
919583754 1:199409838-199409860 GTGCATAATAATAATAATGTAGG - Intergenic
921740982 1:218684492-218684514 GGTAATAATAATGATGTTGAGGG + Intergenic
921745116 1:218731690-218731712 GGCCATAAGAATAAAGAGAAAGG - Intergenic
921916918 1:220623565-220623587 GGCTAGAATAATAATAATAAAGG + Intronic
1064270419 10:13860273-13860295 TGCCATAAAAATAATTAGGAAGG + Intronic
1064634236 10:17347442-17347464 GGCAATGATAATAATGAAGGTGG + Intronic
1064848152 10:19679508-19679530 AGACACAATAAAAATGATGAAGG - Intronic
1065164290 10:22958718-22958740 CGAAATAATAATAATGATAATGG - Intronic
1067207334 10:44230368-44230390 AGACATAATAAAAATGATAAAGG - Intergenic
1067329150 10:45298410-45298432 AGACATAATAAAAATGATAAAGG - Intergenic
1068785724 10:60971065-60971087 ATCAATAATGATAATGATGATGG - Intronic
1069792651 10:71032943-71032965 GAAGATGATAATAATGATGATGG + Intergenic
1069869895 10:71526706-71526728 AGCAATAATAATAACGATCATGG + Intronic
1070736032 10:78864359-78864381 GGCAGTAGTAATGATGATGATGG - Intergenic
1071310456 10:84338560-84338582 GTCCATCATGATGATGATGATGG - Intronic
1073835156 10:107432770-107432792 GATGAAAATAATAATGATGACGG - Intergenic
1073866387 10:107809225-107809247 GACAATAATAATAATACTGACGG - Intergenic
1074032537 10:109703148-109703170 GCCCATAATAATAATAATTGAGG - Intergenic
1074556438 10:114495402-114495424 GGTGATGATGATAATGATGATGG + Intronic
1074978360 10:118599149-118599171 GGGTATAATAATAATTTTGAGGG - Intergenic
1075445728 10:122511430-122511452 AGAAATAATAACAATGATGATGG + Intronic
1075677540 10:124306134-124306156 GGCAATGATGATGATGATGATGG - Intergenic
1079519290 11:21306451-21306473 AAGTATAATAATAATGATGATGG + Intronic
1079801046 11:24869446-24869468 GATAATAATAATAATAATGATGG - Intronic
1080769617 11:35328328-35328350 GGTAATAATAAGAATAATGATGG + Intronic
1080911725 11:36607238-36607260 AGCCATGATGATGATGATGATGG - Intronic
1082088922 11:48072973-48072995 GGCTACAGTAAAAATGATGATGG + Intronic
1083045938 11:59734715-59734737 GGGGATAATAATAATAATAATGG + Intronic
1084285208 11:68126711-68126733 GTCAATAATAATAATAATAATGG + Intergenic
1084444306 11:69194643-69194665 GGTCATGATGATGATGATGATGG + Intergenic
1084581456 11:70026413-70026435 GACAACAGTAATAATGATGATGG + Intergenic
1085870302 11:80341619-80341641 GGCCTTAATGGTGATGATGATGG + Intergenic
1086426333 11:86687217-86687239 GGCACTAATTATAATAATGAGGG + Intergenic
1086834703 11:91606066-91606088 GACCAGAATAAAAATGATAAAGG - Intergenic
1088991468 11:114957296-114957318 GGGGATAATAATAATAATAATGG + Intergenic
1091309953 11:134565692-134565714 GGTGATAATGATGATGATGATGG + Intergenic
1091548616 12:1520983-1521005 GGCCATAATAAAGAAGGTGAGGG - Intergenic
1091979650 12:4854744-4854766 AGTGATGATAATAATGATGATGG - Intergenic
1092218137 12:6696466-6696488 GGCCACGAGAACAATGATGATGG + Exonic
1092685286 12:11036834-11036856 GACGATGATGATAATGATGATGG + Intronic
1093961198 12:25274456-25274478 GCTCATAAAAATAATAATGAGGG - Intergenic
1094176970 12:27550885-27550907 GGCATTAATAATAATAATAATGG + Intronic
1096071657 12:48778783-48778805 TACCATAATAATAATGACAATGG - Intronic
1098541711 12:71664305-71664327 GGCCATATTAATAAAGAGAAAGG + Exonic
1098861320 12:75713851-75713873 GGAGATAATAATAATGGTGTTGG + Intergenic
1099566089 12:84248074-84248096 AGATATAATAAAAATGATGATGG - Intergenic
1100349459 12:93765320-93765342 AGTAATAATAATAATGATGATGG + Intronic
1101849320 12:108389537-108389559 GGCTGAAATGATAATGATGATGG - Intergenic
1101849341 12:108389708-108389730 GGGGATGATAATAATGGTGATGG - Intergenic
1101927293 12:108983355-108983377 GGCAATAACAATGATGATAATGG - Intronic
1102241609 12:111328061-111328083 AACAATAATAATAATGATGAGGG + Intronic
1102547968 12:113670318-113670340 GGTGATAATAATAATAATGATGG + Intergenic
1103198615 12:119068342-119068364 GGTCACAATAGTGATGATGATGG - Intronic
1103199555 12:119076069-119076091 GGTAATGATAATAATAATGATGG + Intronic
1104484345 12:129137076-129137098 GGTGATGATAGTAATGATGATGG - Intronic
1104762162 12:131303744-131303766 GGTGATGATGATAATGATGATGG - Intergenic
1104762168 12:131303798-131303820 GGTGATGATGATAATGATGATGG - Intergenic
1104817608 12:131657001-131657023 GGTGATGATGATAATGATGATGG + Intergenic
1104817614 12:131657055-131657077 GGTGATGATGATAATGATGATGG + Intergenic
1107336473 13:39361178-39361200 GGCGTTAGTAATAATAATGATGG - Intronic
1107761179 13:43680864-43680886 AGACACAAGAATAATGATGAAGG - Intronic
1108251895 13:48575993-48576015 GGTGATAATAATGATGATGATGG + Intergenic
1109114658 13:58366279-58366301 AGCCACACTAATAATGATTATGG - Intergenic
1109191377 13:59327896-59327918 GGCCATAATTATAAGGATTCTGG + Intergenic
1110881006 13:80572341-80572363 GGGCATATTTATTATGATGATGG + Intergenic
1110982958 13:81925378-81925400 TTCCCTAATAAAAATGATGAAGG - Intergenic
1111053633 13:82919477-82919499 GGCAATAAAAAATATGATGAGGG - Intergenic
1111764320 13:92508383-92508405 GGGTACAATAATAATGATTATGG + Intronic
1111964797 13:94849958-94849980 GGCCTTCATAATCATGATGTGGG + Intergenic
1112268296 13:97946166-97946188 AGTCATAATAATAATGTTGGTGG - Intergenic
1112735627 13:102413345-102413367 GATAACAATAATAATGATGATGG + Intergenic
1112914736 13:104534414-104534436 TTCCATAATAATAATGGTAATGG + Intergenic
1113990956 14:16026909-16026931 TGCTATAATAATAATGCTGGTGG + Intergenic
1114034857 14:18614288-18614310 GGTCACAACAATAAAGATGAAGG - Intergenic
1115499461 14:34036264-34036286 GGACATAATGATATTAATGATGG + Intronic
1116149701 14:41125526-41125548 GGTGATAATAATAATGATTATGG - Intergenic
1116353639 14:43899159-43899181 AGCCATTTTAATGATGATGATGG + Intergenic
1116685417 14:48032966-48032988 GGACACAATAAAAATGATAAAGG - Intergenic
1118419907 14:65590516-65590538 GGGAATAATAATAATGAAAAAGG + Intronic
1118453978 14:65928924-65928946 GTCAATGATAATAATAATGATGG + Intergenic
1120087561 14:80291783-80291805 GGCTAAAATAATAAATATGATGG - Intronic
1120120522 14:80674330-80674352 CTCTATAATAAGAATGATGATGG - Intronic
1121063058 14:90934707-90934729 TGCCATAAGAATAATTATAAAGG + Intronic
1121889513 14:97575912-97575934 GGCAATAATGATAACAATGATGG + Intergenic
1121970533 14:98351789-98351811 GGCACTAATACTATTGATGAGGG - Intergenic
1122049826 14:99048724-99048746 GGCCTTAAAAAGCATGATGAGGG + Intergenic
1126323454 15:47449317-47449339 GTCCATAATAAAAATAATGCTGG + Intronic
1126421146 15:48473658-48473680 GACGATAATGATGATGATGATGG + Intronic
1129341475 15:74889311-74889333 GGACATACTAGTGATGATGATGG - Intergenic
1130430623 15:83843443-83843465 GGCCATAATTAGAATCAAGATGG - Intronic
1131924040 15:97362508-97362530 AACCATAACAATAATCATGAAGG - Intergenic
1132458911 16:39823-39845 AATAATAATAATAATGATGATGG - Intergenic
1133437743 16:5794357-5794379 GGCAATGATGATAATAATGATGG - Intergenic
1133815145 16:9191458-9191480 GGTGACAATAATTATGATGATGG + Intergenic
1135907483 16:26526092-26526114 AGCCATGATGATGATGATGATGG - Intergenic
1137635069 16:49978950-49978972 TGTGATAATAGTAATGATGATGG - Intergenic
1137635070 16:49978981-49979003 TGTGATAATAGTAATGATGATGG - Intergenic
1138233581 16:55359840-55359862 AGTAATAATAATAATGATAATGG + Intergenic
1138528856 16:57624071-57624093 TATCATAATAATAATGATGTTGG + Intronic
1138987898 16:62353524-62353546 GACGATGATAATTATGATGATGG + Intergenic
1139094371 16:63686402-63686424 AATAATAATAATAATGATGATGG + Intergenic
1140276607 16:73514466-73514488 AGTAATAATAATAATAATGATGG - Intergenic
1141134933 16:81458937-81458959 GGTCATGATGATGATGATGATGG - Intronic
1141192596 16:81835293-81835315 TGTTATAATAATAATGAAGATGG + Intronic
1141823691 16:86464639-86464661 GGCAATGATGATGATGATGATGG + Intergenic
1141843608 16:86591559-86591581 GGTGATGATAATGATGATGATGG + Intergenic
1141932253 16:87213764-87213786 GGCGATAGTGAAAATGATGACGG + Intronic
1142103525 16:88289155-88289177 GGCAATGATGATGATGATGAGGG + Intergenic
1143789129 17:9279385-9279407 TTCATTAATAATAATGATGATGG - Intronic
1143849959 17:9803401-9803423 GGATATAAGAATAATGATGCTGG - Intronic
1143919715 17:10321203-10321225 GATGCTAATAATAATGATGATGG + Intronic
1146424286 17:32721660-32721682 TGCAATAATATTAATAATGATGG - Intronic
1146675402 17:34770073-34770095 GGTGATGATGATAATGATGATGG + Intergenic
1148407861 17:47435356-47435378 GGCCATAATTAAATTGATGTCGG + Intronic
1149005383 17:51799764-51799786 GGTCACATTAATAATGATCAGGG + Intronic
1149630455 17:58117590-58117612 GGCGATGATGATAGTGATGACGG + Intergenic
1151432873 17:74076429-74076451 GGCGGTAATAATGATGGTGATGG + Intergenic
1151900845 17:77013152-77013174 GGCGATAAGAATAATGAGGCTGG + Intergenic
1154114965 18:11605750-11605772 GGACATAACAATAATAATAAAGG + Intergenic
1155883932 18:31184689-31184711 AGTGATTATAATAATGATGATGG - Intergenic
1156089348 18:33446877-33446899 GGTCATAATAATCATGAGGGAGG + Intergenic
1156283298 18:35663319-35663341 GGCCATAAGAATAACAATGAAGG + Intronic
1156795582 18:41041836-41041858 GATGTTAATAATAATGATGATGG + Intergenic
1158134850 18:54196724-54196746 GGCTATAGTGATAATCATGAAGG - Intronic
1158363981 18:56709424-56709446 TTACATAATAATAATAATGATGG + Intronic
1159239758 18:65727257-65727279 AGCAATAATAATAAAGATCAAGG + Intergenic
1160112060 18:76042520-76042542 ATCCAGAATAATAATAATGATGG - Intergenic
1160180921 18:76635605-76635627 GGTGATGATGATAATGATGATGG + Intergenic
1160181442 18:76640041-76640063 GGTGATGATGATAATGATGATGG + Intergenic
1160320254 18:77884628-77884650 AACCGTAATAATAGTGATGACGG + Intergenic
1160349854 18:78167869-78167891 GGTGTGAATAATAATGATGATGG + Intergenic
1161159939 19:2756278-2756300 GGCCAAAATATTAATGTTGGTGG + Intronic
1162185616 19:8902497-8902519 GGTCATAATAATGATGGTGATGG - Intronic
1163298187 19:16425959-16425981 GGCAAGATTAATTATGATGATGG - Intronic
1164721458 19:30434726-30434748 GGCCATGATAGTGATGATGGTGG + Intronic
1164721470 19:30434834-30434856 GGTAATGATAATGATGATGATGG + Intronic
1164772822 19:30824914-30824936 GATGATGATAATAATGATGATGG + Intergenic
1165324392 19:35105862-35105884 GGTGATAGTAATGATGATGATGG - Intergenic
1168322707 19:55519444-55519466 GGACATGATGATGATGATGATGG + Intergenic
925700645 2:6633972-6633994 GTCCATAATAAAAATTAGGAGGG + Intergenic
926774660 2:16409927-16409949 GGTGATAATAGTAATGTTGAGGG - Intergenic
927078076 2:19600328-19600350 AGCCAAAATAATAAAGATCATGG + Intergenic
928138873 2:28710275-28710297 GGCCACAAAAATAATGGGGATGG - Intergenic
928273265 2:29876371-29876393 GGTGATAGTGATAATGATGATGG + Intronic
930813964 2:55573080-55573102 GTCCATAAAAATAAAGATTAGGG + Intronic
931012741 2:57936069-57936091 GGCAACATTAATAAAGATGATGG - Intronic
931121532 2:59225588-59225610 GGCCCTAAAAATACTGAGGAGGG + Intergenic
932116750 2:69057445-69057467 AGATATAATAATAATAATGAAGG - Intronic
932258433 2:70306771-70306793 GGCAATAATAATAATAATAGTGG - Intergenic
933014459 2:77106788-77106810 GATAATAATAATAATAATGAGGG + Intronic
933285907 2:80384531-80384553 GGCCTTAATGAGGATGATGAGGG + Intronic
934204611 2:89915262-89915284 TTCCAGAATAATAGTGATGATGG + Intergenic
934562844 2:95322062-95322084 GGCCATAAGAATAATGAGGTTGG + Intronic
935074415 2:99726979-99727001 TGTAATAGTAATAATGATGATGG - Intronic
935589745 2:104835554-104835576 TTCCATAACAACAATGATGATGG - Intergenic
935798206 2:106666029-106666051 GACAATAATAATAATAATAATGG - Intergenic
936342324 2:111644855-111644877 GTACAAAACAATAATGATGATGG + Intergenic
936906326 2:117538891-117538913 GGCCACAATGATAATCATAATGG + Intergenic
937692508 2:124772052-124772074 GGGCATAATGTTAATGCTGATGG - Intronic
938327352 2:130419323-130419345 GGTCACAACAATAAAGATGAAGG + Intergenic
938362588 2:130702154-130702176 GGTCACAACAATAAAGATGAAGG - Intergenic
938438981 2:131308794-131308816 GGTCACAACAATAAAGATGAAGG - Intronic
938690186 2:133780832-133780854 GGCAATGATAGTAATGGTGACGG + Intergenic
938713469 2:133996513-133996535 GGGCATAATTGGAATGATGATGG + Intergenic
939050900 2:137306516-137306538 GACGATGAGAATAATGATGATGG - Intronic
939510307 2:143096768-143096790 CCCCATAATAATAAGGATTAAGG + Intronic
940322979 2:152396885-152396907 AGCTTTAAAAATAATGATGAGGG - Intronic
940673940 2:156705727-156705749 TGCTATAATAGTAATGGTGAAGG + Intergenic
941134300 2:161694928-161694950 GGCCATAATAACTTTGATTATGG - Intronic
941263374 2:163325709-163325731 GGTGATAATAACAATGATGATGG - Intergenic
941622059 2:167789526-167789548 TTCCAATATAATAATGATGATGG + Intergenic
944584149 2:201158845-201158867 AATAATAATAATAATGATGAGGG - Intronic
945441391 2:209884316-209884338 GTCTATAATAATAAAGAGGAAGG + Intronic
946974054 2:225128306-225128328 AGACACAATAAAAATGATGAAGG + Intergenic
946990315 2:225322026-225322048 GGTCATGATGATGATGATGATGG - Intergenic
947924185 2:233906665-233906687 GAATATAATAATGATGATGATGG + Intergenic
948437681 2:237965322-237965344 GGCCATGACAATAAGGAAGAGGG + Intergenic
1168967682 20:1909082-1909104 GTGAATAACAATAATGATGAGGG + Intronic
1170646473 20:18200702-18200724 GGCCATTATATAAATGATAAAGG - Intergenic
1171258702 20:23711656-23711678 GGTGATAATAATGATGATGATGG - Intergenic
1172262970 20:33584650-33584672 AGCAATAATAATATAGATGATGG + Intronic
1172486438 20:35300748-35300770 AGGGATAATAAAAATGATGAGGG + Intergenic
1172898017 20:38314285-38314307 GGGGATGATGATAATGATGATGG + Intronic
1172898043 20:38314435-38314457 GGGGATGATTATAATGATGATGG + Intronic
1173014988 20:39216611-39216633 GGTGATAATATTAATGATGTTGG - Intergenic
1173140944 20:40482295-40482317 GGCCAGAAGAATAATTATGTGGG - Intergenic
1173323586 20:42011743-42011765 AACCATAGTAATGATGATGATGG - Intergenic
1173507675 20:43601152-43601174 TGCCATAATATTAATGTTTAAGG - Intronic
1174755531 20:53154874-53154896 GTCAATAATGATAATGATGATGG - Intronic
1175574091 20:60047493-60047515 TATGATAATAATAATGATGATGG + Intergenic
1175670147 20:60895404-60895426 GGTGATAATGATAATGGTGATGG + Intergenic
1175670151 20:60895431-60895453 GGTGATAATGATAATGGTGATGG + Intergenic
1178084229 21:29096380-29096402 GGCAATAATAATAATAACTAGGG + Intronic
1180316314 22:11280616-11280638 TGCTATAATAATAATGCTGGTGG - Intergenic
1182163480 22:28147794-28147816 AGTCACAATAATAATGATAAAGG - Intronic
1183055597 22:35303483-35303505 AGAAATAATAAAAATGATGATGG - Intronic
1183092660 22:35533519-35533541 GGTAATAATGATAGTGATGATGG + Intergenic
1183367689 22:37415967-37415989 AAAAATAATAATAATGATGATGG + Intronic
1184263834 22:43335831-43335853 GGTGATGATGATAATGATGATGG + Intronic
1184436333 22:44479970-44479992 GGCGATGATGATAATGATGATGG - Intergenic
1184666902 22:45994064-45994086 GGTGATAATAATGATGGTGATGG + Intergenic
1185200495 22:49500719-49500741 GGGAATAATGATAATGGTGATGG - Intronic
1185209591 22:49562835-49562857 GGTGATAATCATAGTGATGATGG - Intronic
949693943 3:6672369-6672391 GGCAATAATAAGTATAATGATGG + Intergenic
949890652 3:8731465-8731487 CGACATAGTAATAATGATTATGG - Intronic
949929445 3:9067150-9067172 AGGGATAATAATGATGATGATGG - Intronic
950113750 3:10437271-10437293 AGTAATAATAATAATGATGATGG + Intronic
950947368 3:16963350-16963372 AGCCATCATAATCATGAAGATGG + Intronic
951059250 3:18185595-18185617 GGCAATAATATTAATAATAATGG + Intronic
951433334 3:22633658-22633680 GGCCGTAATAATAATAAAAAAGG - Intergenic
951985021 3:28609669-28609691 TGCTAGAATAATAATGGTGAAGG + Intergenic
952499601 3:33948295-33948317 GTTAATAATAATCATGATGAGGG - Intergenic
954518526 3:51201425-51201447 GGCCATTACAATAATGGTAAAGG + Intronic
954913911 3:54133163-54133185 AGTAATAATAATAATGATGCAGG + Intronic
957274665 3:78075419-78075441 AGGTATAATAATAATAATGAGGG - Intergenic
957415499 3:79897589-79897611 CACCATAATAATAATAATAATGG - Intergenic
957706443 3:83792350-83792372 AGGCATAAGAATAATTATGATGG + Intergenic
958478073 3:94610629-94610651 TGCCAAAATAATAAAAATGATGG - Intergenic
958520290 3:95177113-95177135 GGCCAGATTATTAATGATGTTGG - Intergenic
959205542 3:103302039-103302061 AGACATAATAAAAATGATAAAGG - Intergenic
959906379 3:111715517-111715539 AGCCATACTAATAATGGAGAGGG + Intronic
960346902 3:116544442-116544464 AGCCATAAAAATAATGAGGTCGG + Intronic
960634808 3:119773969-119773991 GGCCAAAATAATCTTGATAAAGG + Intergenic
962363618 3:134762129-134762151 GGCCATATTAATCATCATGTAGG - Intronic
963401332 3:144802885-144802907 AGTAATAATAATAATGAAGAGGG - Intergenic
964499683 3:157335073-157335095 GAGCATTATAATATTGATGAAGG - Intronic
964586760 3:158315157-158315179 ACCCATAATACTAATAATGAAGG + Intronic
964646858 3:158967842-158967864 GGCTAGAATAATAAAGATGAAGG + Intronic
965148317 3:164936065-164936087 GTGCATAATAAGAATGAAGAAGG - Intergenic
967491034 3:190090928-190090950 GGCTATGATAGTATTGATGAGGG - Intronic
969169794 4:5351594-5351616 GGACAAAATAATAAAGATCAGGG + Intronic
969234585 4:5856712-5856734 AGCGATAATGATAGTGATGACGG - Intronic
969503075 4:7566024-7566046 GGTGATAATGATAGTGATGATGG + Intronic
969806390 4:9612217-9612239 AATAATAATAATAATGATGATGG + Intergenic
969967460 4:11011904-11011926 GTCAATAATAATAATAATGTAGG - Intergenic
970171404 4:13294731-13294753 GGTGATAATAATAATAATAATGG + Intergenic
970820709 4:20208904-20208926 GGCCCTTATAAAAATGTTGAAGG + Intergenic
971031118 4:22637806-22637828 GACTTTATTAATAATGATGATGG - Intergenic
971435937 4:26623768-26623790 AGTCACAATAATGATGATGATGG + Intronic
972019812 4:34298023-34298045 TGACAAAATAATAATGATGCTGG - Intergenic
972106069 4:35489368-35489390 TCCCAAAATAAAAATGATGATGG + Intergenic
972698016 4:41466729-41466751 AAACATAATAATAATAATGAAGG - Intronic
974629381 4:64463529-64463551 GGCCATATTTAGAAAGATGAAGG + Intergenic
974656266 4:64826663-64826685 GCCTATAATAATAATGAGAATGG + Intergenic
977524593 4:98128498-98128520 GGTTATCATATTAATGATGATGG - Exonic
977583849 4:98753695-98753717 GGTCATGATGATGATGATGATGG - Intergenic
977892705 4:102330313-102330335 GGACATATTAAAAATGATAAAGG + Intronic
977925125 4:102691963-102691985 GGCAATAACAAAATTGATGAGGG + Intronic
978543168 4:109840930-109840952 GCAAATAATAATAATGATGATGG - Intronic
978661135 4:111127924-111127946 GGTCCTAATAAAAAAGATGAAGG - Intergenic
979559902 4:122089796-122089818 GGCTATAATAATAAGTATGTAGG - Intergenic
979708729 4:123751647-123751669 AGCTATAATGATGATGATGATGG - Intergenic
980111055 4:128637249-128637271 AGAGATAATAAGAATGATGATGG - Intergenic
980393541 4:132177502-132177524 GGTGATAATAATAATAATAATGG + Intergenic
982622105 4:157721493-157721515 GAAAATAATAATAATGATAATGG - Intergenic
982635374 4:157889018-157889040 GGTGATAATACTAATGATGCTGG + Intergenic
983741802 4:171143586-171143608 GGCATTAATAATAAAGATCAAGG - Intergenic
983934752 4:173493651-173493673 GGCAACATTAATAGTGATGACGG - Intergenic
985857310 5:2439858-2439880 GGTGATAATGATGATGATGATGG - Intergenic
985857325 5:2440032-2440054 GGTGATAATAATGATGGTGATGG - Intergenic
986279137 5:6308896-6308918 GGCGATGGTAATGATGATGATGG + Intergenic
986738631 5:10686048-10686070 AGACATAATAATAATGAAGATGG - Intronic
986886820 5:12248169-12248191 GGACATACTAATAATGAACAGGG - Intergenic
988701007 5:33674505-33674527 GTCCATAATAATAAAGGTGATGG + Intronic
989058044 5:37383567-37383589 AACAATAATAATAATAATGATGG - Intronic
990017940 5:51089075-51089097 AGCCAAAATAATAATGATAACGG - Intergenic
990974904 5:61551138-61551160 TGCCATAACTATTATGATGATGG - Intergenic
991551571 5:67842714-67842736 TGCTATCATAATGATGATGATGG - Intergenic
992201410 5:74388126-74388148 GGCCATAATAAATATGAGAAGGG + Intergenic
993530368 5:89017256-89017278 TACAATAACAATAATGATGATGG - Intergenic
993849090 5:92983501-92983523 AACCATAGAAATAATGATGATGG + Intergenic
993964236 5:94341431-94341453 CTCCATGATAATGATGATGATGG - Intronic
994670392 5:102755596-102755618 GGACTTAATAATGGTGATGAAGG - Intronic
995011958 5:107266148-107266170 GACCATTATAAGCATGATGAAGG - Intergenic
995426926 5:112035165-112035187 GGCAATAATAAAAATGATGAAGG + Intergenic
995572029 5:113490675-113490697 GGTCATAATCAGAATGCTGATGG + Intergenic
995690776 5:114824177-114824199 GGCTATAATTATAATTATAATGG + Intergenic
997940206 5:138150413-138150435 GATAATATTAATAATGATGACGG + Intronic
998557021 5:143135381-143135403 AGTTATAATAATGATGATGATGG - Intronic
999031143 5:148292606-148292628 AGCAATGATAATTATGATGATGG - Intergenic
1000012934 5:157249861-157249883 AGCTACAATAATAATAATGATGG + Intronic
1000365696 5:160488795-160488817 GGGAGTAATAATAATGATAATGG + Intergenic
1000502133 5:162065395-162065417 GGCCATTATAAGACTGATAAGGG + Intergenic
1000660823 5:163936131-163936153 AGACATAATAAAAATGATAAAGG + Intergenic
1000716303 5:164649219-164649241 GGCCACAATATTTATGATGATGG + Intergenic
1001298648 5:170517480-170517502 GGCAATAATGATGATGATGATGG + Intronic
1001298729 5:170518056-170518078 GGTCATAATGATAGTGATGGTGG + Intronic
1001359534 5:171067297-171067319 GGCAATAATAATAATGCAAAGGG - Intronic
1001865312 5:175099092-175099114 GACAACAATGATAATGATGATGG - Intergenic
1003012719 6:2441001-2441023 TGAAATAATAATAATAATGAGGG - Intergenic
1003430833 6:6035965-6035987 GGTGATGATGATAATGATGATGG - Intergenic
1003547686 6:7074356-7074378 GGACTTACTAACAATGATGAAGG + Intergenic
1005509591 6:26500572-26500594 GGCAATGATAATAAAGATAAGGG - Intergenic
1006469923 6:34223023-34223045 GGCAAAAATGATAATCATGAGGG - Intergenic
1008758842 6:54829996-54830018 AGTCAAAATAATAATTATGATGG - Intergenic
1009604713 6:65851927-65851949 GGTGATAGTGATAATGATGATGG - Intergenic
1010106586 6:72177085-72177107 GAGCACAATAATACTGATGAAGG - Intronic
1012217493 6:96605561-96605583 GGCCATAATAATCATTACAAGGG - Intronic
1012589795 6:100967270-100967292 GGCCTTTCTAATAATTATGAAGG - Intergenic
1013950150 6:115770825-115770847 GGACATAATTATACTGATGCAGG + Intergenic
1014101792 6:117518943-117518965 GGCAACAACAATCATGATGAAGG - Intronic
1014704928 6:124734311-124734333 GGCCATGATAATAATTTAGAGGG - Intronic
1014704987 6:124734951-124734973 GGCAAGAAGAATAAGGATGAAGG - Intronic
1015946344 6:138505017-138505039 GGCCTTCATAAAAATAATGAGGG - Intronic
1016888978 6:148986799-148986821 AGACATAAAAATGATGATGACGG - Intronic
1018740439 6:166724360-166724382 GGCCCTTAGAATAATGATAAAGG - Intronic
1019841371 7:3449409-3449431 TGCCATTATACAAATGATGAAGG + Intronic
1019987709 7:4669900-4669922 GATGATGATAATAATGATGATGG - Intergenic
1020349900 7:7208262-7208284 GGGCACAAGAATAGTGATGATGG + Intronic
1021475163 7:21052608-21052630 TTCTATAATAATGATGATGATGG + Intergenic
1021532378 7:21662189-21662211 TGCTATGACAATAATGATGATGG + Intronic
1022682869 7:32566465-32566487 AGCCAAAATAATAATGTTTAAGG + Intronic
1023022209 7:36020283-36020305 GGCCCTATTAACAATGATGCTGG - Intergenic
1023225573 7:37965505-37965527 GCCAATAATAATGATGATCATGG + Intronic
1024334579 7:48194355-48194377 GGAGATGATAATAGTGATGATGG + Intronic
1026286461 7:68967822-68967844 GGTGATGATGATAATGATGATGG + Intergenic
1026376714 7:69758986-69759008 GAGGATAATAATAATTATGATGG + Intronic
1027423103 7:78036400-78036422 GTAAATAATAATAATAATGATGG + Intronic
1028062189 7:86335632-86335654 TGTCATAATAGTTATGATGATGG - Intergenic
1029048540 7:97658211-97658233 AGTCATAAAAATAATTATGATGG - Intergenic
1030718671 7:112842472-112842494 GGCCAAAATCCAAATGATGACGG - Intronic
1031078336 7:117233965-117233987 AGCCATAATAATTTTGATGCTGG - Intergenic
1031823773 7:126536219-126536241 AGCCACCATAAGAATGATGAAGG - Intronic
1033816961 7:145085054-145085076 AGCCATATCAATACTGATGAAGG - Intergenic
1033883150 7:145912477-145912499 GGCTATGATTATAATGATGGTGG + Intergenic
1034128549 7:148695948-148695970 GGACAAAATTATAATGATGAAGG + Intergenic
1034608261 7:152338427-152338449 GGACACAATAATGATGATGCTGG + Intronic
1034679055 7:152914369-152914391 GGCAATAGTAATGATTATGATGG - Intergenic
1034679082 7:152914751-152914773 GGTCATAATGATAATGGTGATGG - Intergenic
1034714805 7:153231857-153231879 GGACACAATAAAAATGATAAAGG - Intergenic
1035106942 7:156449108-156449130 GGTCATAGTGATGATGATGATGG + Intergenic
1036532128 8:9601409-9601431 GGCAATACAAACAATGATGATGG - Intronic
1038075694 8:24070946-24070968 TGCCATGATGATGATGATGATGG - Intergenic
1038298022 8:26314374-26314396 GATCACAATGATAATGATGAAGG - Intronic
1040066786 8:43151740-43151762 GTTCATAATAATAAAGACGATGG + Intronic
1040929581 8:52719649-52719671 AAACATACTAATAATGATGATGG + Intronic
1042645719 8:70983947-70983969 GGCCTGAATAACAATCATGATGG + Intergenic
1042660665 8:71150708-71150730 GATGATAATAATGATGATGATGG - Intergenic
1042897056 8:73682011-73682033 GGGCAAAATAATAATAGTGAGGG + Intronic
1043021205 8:75002496-75002518 AAAAATAATAATAATGATGAAGG + Intronic
1043239289 8:77912134-77912156 CACCATAATAAAAATGATAAAGG + Intergenic
1044742588 8:95342949-95342971 GGCCATAATCCTATTTATGAGGG + Intergenic
1044818317 8:96135864-96135886 AAAAATAATAATAATGATGATGG + Intergenic
1047291002 8:123530593-123530615 GAGCAAAATATTAATGATGAAGG - Intronic
1047629371 8:126690323-126690345 GACAATAATGATAATGAGGATGG + Intergenic
1047815819 8:128461133-128461155 AGAAATAATAATAATGATGATGG + Intergenic
1048623549 8:136160544-136160566 GGCTATAATGATATTGATAAAGG + Intergenic
1048848126 8:138619058-138619080 GGTATTAATAATAATGATGATGG - Intronic
1049292029 8:141808891-141808913 GGTGATGATAGTAATGATGATGG - Intergenic
1050411046 9:5365235-5365257 TAAAATAATAATAATGATGATGG + Intronic
1051235655 9:14995953-14995975 TGACATAAGAATAATCATGATGG - Intergenic
1055547004 9:77388142-77388164 AGCTCAAATAATAATGATGATGG + Intronic
1055848518 9:80596005-80596027 GGCCCTATTAATAAAGATGATGG + Intergenic
1056240456 9:84641442-84641464 AGTCATCATAAGAATGATGAAGG - Intergenic
1057045675 9:91884579-91884601 TGCCAGAATATTAATGCTGAAGG + Intronic
1057382293 9:94579833-94579855 GGCCATAATAATAAAATTGGAGG - Intronic
1058135945 9:101307613-101307635 GGCCACAAAAAGAAAGATGATGG + Intronic
1058929645 9:109706262-109706284 ACTCATAATAATGATGATGATGG + Intronic
1058955495 9:109943115-109943137 GCCCATAAAAATCATGGTGACGG - Exonic
1059017789 9:110540148-110540170 GATGATAATGATAATGATGATGG - Intronic
1059257016 9:112940079-112940101 GACCAGAATAATAAAGATAACGG + Intergenic
1059436235 9:114278208-114278230 GACGATAATAATGATGGTGATGG + Intronic
1059436270 9:114278425-114278447 GGTAATGATAATGATGATGATGG + Intronic
1059521364 9:114945308-114945330 GTCAATGATGATAATGATGATGG + Intergenic
1059634269 9:116156009-116156031 ATCCATAATAATAATGACGATGG + Intronic
1060435812 9:123591824-123591846 GGGAATAATAATAATAACGATGG + Intronic
1060605509 9:124910414-124910436 AAACATTATAATAATGATGATGG + Intronic
1060806555 9:126581267-126581289 GGCAACAATAATGAAGATGATGG - Intergenic
1185721209 X:2383098-2383120 GGTGATAGAAATAATGATGATGG - Intronic
1185930148 X:4193711-4193733 GGTGATAATGATAATGATGATGG + Intergenic
1185977266 X:4735386-4735408 GATGATAATAATAATGATGGTGG - Intergenic
1185977267 X:4735389-4735411 GGTGATGATAATAATAATGATGG - Intergenic
1186732012 X:12420121-12420143 GGCCATGAGAATAGAGATGAAGG - Intronic
1186777396 X:12879126-12879148 GGCAATATTCATAATGATGTTGG - Intronic
1187204842 X:17171929-17171951 GTTAATAATAATAATGATGGTGG + Intergenic
1187699046 X:21947200-21947222 GGACAGGATAATAATGCTGAAGG - Intronic
1188605578 X:32024814-32024836 AGCAATAGTAATAATGATGATGG - Intronic
1188946343 X:36308036-36308058 GCCCCCAATAATTATGATGAAGG - Intronic
1189050990 X:37645356-37645378 GCCCAGCATAATAATGATCAGGG + Intronic
1189102215 X:38202507-38202529 GGACATAATAAAAATAATAAAGG + Intronic
1190496961 X:51035890-51035912 AACCAGAATAATAATGATAATGG + Intergenic
1190853921 X:54274426-54274448 GTCCATAATAATAAGCGTGAAGG - Intronic
1191208387 X:57858256-57858278 AGACACAATAAAAATGATGAAGG + Intergenic
1192006623 X:67220709-67220731 AGAAATAATAAAAATGATGAAGG - Intergenic
1192292080 X:69808850-69808872 TGCCATAATACTACTGATTAAGG - Intronic
1192702896 X:73494895-73494917 AGACACAATAAAAATGATGAAGG - Intergenic
1193424052 X:81319223-81319245 TGCCATAATAATAATAATAAAGG - Intergenic
1194576043 X:95615781-95615803 AGACATAATAAAAATGATAAAGG - Intergenic
1194670932 X:96731355-96731377 GGCCATTACAATAGAGATGAAGG - Intronic
1194708754 X:97207413-97207435 GGCGATGATGATGATGATGATGG + Intronic
1195243322 X:102974349-102974371 GGCCATTTTAAAAATGATGTTGG - Intergenic
1198671856 X:139089839-139089861 ATCAATAATAATAATAATGATGG - Intronic
1199049982 X:143226474-143226496 GGCCAAAATAAGAACTATGATGG + Intergenic
1199157160 X:144563755-144563777 AGCCATCATTATAGTGATGACGG - Intergenic
1201143533 Y:11048166-11048188 GACCATGATGATAATGGTGATGG + Intergenic