ID: 904473590

View in Genome Browser
Species Human (GRCh38)
Location 1:30750748-30750770
Sequence ATGAGGAAACAGGCTCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1542
Summary {0: 1, 1: 13, 2: 100, 3: 336, 4: 1092}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904473590_904473595 -9 Left 904473590 1:30750748-30750770 CCCTCCTGAGCCTGTTTCCTCAT 0: 1
1: 13
2: 100
3: 336
4: 1092
Right 904473595 1:30750762-30750784 TTTCCTCATCTGTAAAATGGAGG 0: 94
1: 584
2: 1498
3: 3030
4: 5403
904473590_904473604 30 Left 904473590 1:30750748-30750770 CCCTCCTGAGCCTGTTTCCTCAT 0: 1
1: 13
2: 100
3: 336
4: 1092
Right 904473604 1:30750801-30750823 CATTTTTCCGGTGCCACAAATGG 0: 1
1: 0
2: 2
3: 8
4: 115
904473590_904473602 18 Left 904473590 1:30750748-30750770 CCCTCCTGAGCCTGTTTCCTCAT 0: 1
1: 13
2: 100
3: 336
4: 1092
Right 904473602 1:30750789-30750811 CGTGGCAGCTGCCATTTTTCCGG 0: 1
1: 0
2: 1
3: 15
4: 138
904473590_904473597 0 Left 904473590 1:30750748-30750770 CCCTCCTGAGCCTGTTTCCTCAT 0: 1
1: 13
2: 100
3: 336
4: 1092
Right 904473597 1:30750771-30750793 CTGTAAAATGGAGGCCCCCGTGG 0: 1
1: 0
2: 0
3: 6
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904473590 Original CRISPR ATGAGGAAACAGGCTCAGGA GGG (reversed) Intronic
900756969 1:4442709-4442731 ATGAGGGGAGAGGCTCAGGCTGG + Intergenic
900876168 1:5343969-5343991 ATGAGAAAACAGACTCAGAGAGG - Intergenic
900890803 1:5448359-5448381 TTGAGGAGACAGGGGCAGGAGGG + Intergenic
901669793 1:10849564-10849586 GTGAGGAAACAGGCTCAGAGAGG - Intergenic
901897272 1:12324872-12324894 ATGAGGAAACCAGCTCAGATTGG + Intronic
902083740 1:13840237-13840259 ATGAGGAAACAGTTTCAATATGG + Intergenic
902134717 1:14295056-14295078 ATGAGGAAACAAACTCAGAGAGG - Intergenic
902212833 1:14915989-14916011 ATGAGGAAACAGACACAGAGAGG - Intronic
902405179 1:16178918-16178940 TTGAAGAAACAGGCTCAGGGAGG - Intergenic
902567022 1:17318317-17318339 ATGAGAAAACAGGTTCAGAGAGG - Intronic
902619939 1:17644925-17644947 ATGAGGCCACAGGCTCAGAGAGG + Intronic
902791998 1:18775708-18775730 AGGAGGAGACAGGCTCATAAGGG - Intergenic
902927265 1:19704380-19704402 ACGAGGAAACAGGGTCAGAGAGG + Intronic
903007963 1:20310842-20310864 ATGAGGAAACAGACTCGGAGGGG - Intronic
903037720 1:20504901-20504923 ACAAGGAAACAGGCTCAGAGAGG + Intronic
903221755 1:21873261-21873283 ATGAAGAAACAGGCTCGGACAGG + Intronic
903328683 1:22585999-22586021 ATGAGGAAGCAGGCCAGGGATGG - Intronic
903469204 1:23573758-23573780 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
903610728 1:24610082-24610104 ATCAGGAAACAGGTTCAGCAAGG + Intergenic
903748865 1:25606679-25606701 ATAAGAAAACAGGCTCAGAGTGG + Intergenic
903803200 1:25985215-25985237 CTGGGCAAACAGGCTCTGGAAGG - Intronic
903891905 1:26575339-26575361 ATGGGGAAACAGGCTCAAGTTGG + Intergenic
903893100 1:26583297-26583319 ATGAGGATAAAGGCTCTGGCAGG + Intergenic
903921164 1:26802117-26802139 ATGAGAAAACAGGCTTAGAGAGG - Intergenic
903992547 1:27283792-27283814 ATGAGCAAACAGGCTCAGACAGG - Intronic
904129470 1:28265049-28265071 ATGAGGAACAAGGCTCAGAGAGG - Intronic
904260138 1:29283398-29283420 CTGAGAAAGAAGGCTCAGGAAGG - Intronic
904287053 1:29459607-29459629 ATGAGGAAAAAGGCTTAGAGAGG + Intergenic
904473590 1:30750748-30750770 ATGAGGAAACAGGCTCAGGAGGG - Intronic
904535519 1:31196939-31196961 ACCAAGAAACAGGCACAGGAAGG - Intronic
904597001 1:31653141-31653163 ATGAGGACACAGGCTCAGAGAGG + Intronic
904617900 1:31759888-31759910 AGAGGGAAACAGGCTCAGGGGGG - Intronic
904790137 1:33013634-33013656 GTGAGGAAAGGGGCTCATGAGGG + Intronic
904790916 1:33020499-33020521 ATAAGGAAACAGCCTCAGAGAGG + Intronic
904846349 1:33420919-33420941 ATGAAGAAACAGGCTCAAAGAGG - Intronic
904880424 1:33692381-33692403 ATGAGGAAACAGCCTAAAAAAGG + Intronic
904940091 1:34159623-34159645 ATGAAGAAACAGGTTCAGAGAGG - Intronic
904989543 1:34580664-34580686 ATGAGGCAGTAGTCTCAGGAAGG - Intergenic
905003322 1:34690623-34690645 ATGACGAAACAGGCACAGAGTGG - Intergenic
905103511 1:35546312-35546334 GTGAGGAAACGGTCTCAAGAAGG + Intronic
905291177 1:36922731-36922753 ATGAGGAAACAGGTTCCGGGAGG + Intronic
905295536 1:36952055-36952077 ATGCAGAAACAGGGTCAGCAAGG + Intronic
905301875 1:36991133-36991155 ATGAGAAGACAGGCTCAGAGAGG - Intronic
905462442 1:38130487-38130509 AGGAGGAAGCAGGCTCAGAGAGG + Intergenic
905476873 1:38235200-38235222 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
905646388 1:39627309-39627331 ATGGGGAGACAGGCTCAGAGAGG - Intronic
905652927 1:39668521-39668543 ATGGGGAAACAGGCCCAGAAAGG + Intronic
905732329 1:40305562-40305584 ATAGGGAAACAGGCCCAGGGAGG + Intronic
905833900 1:41099742-41099764 ATAAGGAAACGGGCTCAGAAAGG - Intronic
905884709 1:41485370-41485392 ACAAGGAAACAGGCCCAGGAAGG - Intergenic
906383171 1:45345676-45345698 ATGAAGAAACAGACTCAGAGAGG + Intronic
906481210 1:46200215-46200237 AGGAGAAAAGAGGGTCAGGAAGG - Intronic
906488657 1:46250518-46250540 ATGAGAAAACAGTCTCAGAAGGG + Intronic
906647211 1:47483786-47483808 ATGACCAAGCAGGCTGAGGATGG + Intergenic
906674216 1:47681517-47681539 ATGAGGAAACTGGCTCAGAAAGG - Intergenic
906689639 1:47784130-47784152 ATGAGGAAACAGGCTCAGTGAGG + Intronic
906808830 1:48805789-48805811 ATGAGGAAACAGGCTGAGAGAGG - Intronic
906839883 1:49125735-49125757 ATGAGAAAAAAGGCTCAGAGAGG + Intronic
907076998 1:51587998-51588020 ATGAGGAAACAGGTTCAGAGAGG - Intronic
907134596 1:52127903-52127925 ATTAGGAAACAGGTTCAGAGAGG - Intergenic
907159381 1:52359641-52359663 TAGGGGAAACAGGCTCAGAAAGG - Intronic
907275028 1:53312175-53312197 ATGGGGAAACAGGCCAGGGAGGG + Intronic
907311019 1:53539047-53539069 ATGAGGAAAGAGGCTCTGCCAGG + Intronic
907355381 1:53868385-53868407 ATGAGGAAACTGAGACAGGAAGG - Intronic
907571042 1:55484238-55484260 ATGAGGATACAAGCCCAGGTTGG + Intergenic
907647788 1:56261526-56261548 ATGAGAAAACAGGATCAGAGTGG - Intergenic
907747369 1:57226711-57226733 GTGAGGAAACAGGCTGAGAAAGG + Intronic
907782201 1:57577560-57577582 ATAAAGAAACAGGCTCAGAGAGG + Intronic
908028725 1:59977315-59977337 ATGAGGAAATAGGCACAGCATGG + Intergenic
908395251 1:63719505-63719527 ATAAGGAAACAGACACATGAGGG - Intergenic
908797987 1:67850566-67850588 ATGAAGAAAGAGGCTCAGAGAGG - Intergenic
908916250 1:69129854-69129876 ATAACGAAACAGGGTAAGGAGGG + Intergenic
909504542 1:76373286-76373308 ATGAGAAAACAGGCCCAGCAAGG - Intronic
909661016 1:78082150-78082172 ATGTGGAAACAGGCTCAGGAAGG + Intronic
909986509 1:82167261-82167283 ATGAAAAAAAAGGCTCAGGCAGG - Intergenic
910473035 1:87575962-87575984 ATGAGGAAATAGGCTTAGAATGG + Intergenic
910514379 1:88042741-88042763 ATGAGAAACCAGGTTCTGGAAGG + Intergenic
911052693 1:93684595-93684617 GGGAGGAAACAGACTCAGGAAGG + Intronic
911054685 1:93699858-93699880 ATGAGGAAACAGACCCAGAGAGG + Intronic
911061284 1:93750320-93750342 ATGTGGAAACAGCCTCGGAAAGG - Intronic
911069172 1:93818560-93818582 GTGAGGAAACAGGCTCTGAGTGG - Intronic
911153423 1:94617281-94617303 ATGAGGAAATAGGCTTAGAGAGG + Intergenic
911203923 1:95073970-95073992 ATGAGTAAAAAGGTTCAGAAAGG + Intergenic
911582020 1:99644931-99644953 ATGAGGGAACAGGCTCAGAGAGG - Intergenic
912107927 1:106304067-106304089 ATGAAAAAGCAGGTTCAGGAAGG - Intergenic
912310664 1:108617796-108617818 ATGAAGAAACGGCCTCAGAAAGG + Intronic
912404611 1:109426478-109426500 AATAGGAAGCAGGCACAGGAGGG - Intergenic
912587730 1:110782016-110782038 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
912723464 1:112039346-112039368 CTGAGGAAACAAGCTCAGAGAGG - Intergenic
912812053 1:112802213-112802235 ATGAGGGAACAGGCCCAGCCAGG + Intergenic
913047588 1:115087702-115087724 ATGAGGAAACAGGCTCAAATTGG - Intronic
913233827 1:116763675-116763697 AGAAGGAAACAGGCTCAGAGAGG + Intronic
913244536 1:116860076-116860098 CAGAGGACGCAGGCTCAGGAGGG - Intergenic
913445131 1:118943059-118943081 ATGAAGAAATTGGCTCAGAAAGG - Intronic
913539462 1:119804975-119804997 GTGAGGAAACAGGCTCAGGATGG + Intronic
914256436 1:145963819-145963841 ATGAGGAAACAGACTTAATAAGG + Intronic
914445637 1:147748531-147748553 ATGAGGAAACAAGCTCAAAGAGG + Intergenic
914447147 1:147759727-147759749 ATGAAGAAACAGACTCAGTGAGG - Intronic
914845206 1:151280097-151280119 ATGAGAAAACAGGATCTGGGAGG + Exonic
914965016 1:152248630-152248652 ATGAGGAAACAGACTCAGAAAGG - Intergenic
914973441 1:152333211-152333233 ATGAGGAAACAGACCCAGAAAGG - Intergenic
915596730 1:156900518-156900540 ATGAGGAAGCAGGCACAGAGAGG - Intronic
915599670 1:156914265-156914287 ATGAGGACACAGGCTCTGAGAGG - Intronic
915676777 1:157539240-157539262 ATGATGAAACTGGTACAGGATGG + Exonic
916179778 1:162073216-162073238 ACGAGGACATAGGCTCAGGGAGG + Intronic
916211877 1:162366369-162366391 ATGAGGTAACAGACTCAGGGAGG + Intronic
916880032 1:169011819-169011841 ATGAGGAAGCAGGCTTAGGGAGG - Intergenic
916943627 1:169701817-169701839 ATGAGGAAACTGGCATGGGAAGG + Intronic
916987843 1:170210480-170210502 ATGAGGAAACTGGTACAGGTAGG + Intergenic
916996795 1:170309876-170309898 AAGGGGAAACAGTCTCAGTAGGG - Intergenic
917347206 1:174040562-174040584 ATGAGGAAACAGGCACAGAAGGG + Intergenic
917612395 1:176701861-176701883 AAGAGGAAAAGGGCTCAAGAAGG - Intronic
917791617 1:178502807-178502829 ATGAGGAAACAAGTTCAGAGAGG + Intergenic
917852860 1:179080275-179080297 GTGAGGAAACAGGCATGGGACGG + Intergenic
917965281 1:180174867-180174889 ATGAAGAAACAGGCTCGGCCAGG + Intronic
918001085 1:180496912-180496934 ATGAAGAGAGAAGCTCAGGAGGG + Intronic
918180473 1:182082585-182082607 AAGAGGAAACAGGCACAGAGAGG + Intergenic
918209953 1:182341677-182341699 AGGAGGAAATAGGCTCAAGGAGG - Intergenic
918346571 1:183612633-183612655 ACGAAGAAACAGGCTCAGAAAGG + Intergenic
918362694 1:183775011-183775033 ATGAGAAAACAAAGTCAGGAGGG - Intronic
918382463 1:183969890-183969912 ATGAGGAAATAAGCGCAGCAAGG - Intronic
918489055 1:185060826-185060848 TTGAGGAAACAGGCTGGGCAAGG + Intronic
919357641 1:196545444-196545466 TTGAGGAAACAGGATCAGGCTGG + Intronic
919516853 1:198535757-198535779 CTGAGGAAACAGGCACAGCAAGG + Intronic
919561876 1:199131332-199131354 ATGAAGAAACATGCTCAGTGAGG + Intergenic
919743868 1:200996524-200996546 ATGATGAAACAGGCTCAGAGAGG - Intronic
919765171 1:201122516-201122538 AAGAGGAAACAGGCTCAGAGAGG + Intronic
919766344 1:201129779-201129801 ATGAGGAAACCGGCTCAAAAGGG + Intergenic
919975232 1:202606215-202606237 ATGGGGAAACAGGTTCAGAGAGG + Intronic
920048599 1:203149739-203149761 ATGAGCAAGAAGGCTCAGAATGG + Intronic
920124840 1:203685737-203685759 AAGAAGAAACAGACTCAGGGAGG - Intronic
920176804 1:204107209-204107231 ATGAGGAGACAGGCTAAGGGAGG + Intronic
920365861 1:205448130-205448152 GTGAGGAAACAGGGCCAGAAGGG + Intronic
920563599 1:206956789-206956811 ATGAGGGAGCAGGCTCTGCAAGG - Intergenic
920683230 1:208089259-208089281 ATGAGGATTCAGGCTATGGATGG - Intronic
920697374 1:208191627-208191649 ATGAAGAAACAGGCACAGAGAGG + Intronic
920729394 1:208468634-208468656 ATGAGGAAACAGATTCAGAATGG + Intergenic
920850562 1:209625452-209625474 ATGAGAAAACAGGCACAGACAGG - Intronic
921103525 1:211952455-211952477 ATAAGGAAACAGGCACAGAAAGG + Intronic
921131076 1:212220570-212220592 ATGAGAAAACAGGCACAGAGAGG - Intergenic
921950099 1:220920656-220920678 ATGAGGAAGCAGGGAGAGGAAGG + Intergenic
922057758 1:222057652-222057674 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
922178352 1:223214767-223214789 CTGAGGAAACAGGGCCTGGAGGG + Intergenic
922321015 1:224486929-224486951 CTGACTAAACAGGCTCCGGATGG + Intronic
922490396 1:226011969-226011991 GTGTGGAAACAGACTCAGAAAGG + Intergenic
922495181 1:226051581-226051603 ATGAGGAAATAGGCTAAGGAAGG - Intergenic
922504615 1:226119273-226119295 ATAAGGAAACAGTCTCAGAGAGG + Intergenic
922532585 1:226355800-226355822 ATGTGGAAACAGGCTCAGAGAGG - Intergenic
922580900 1:226697204-226697226 ACAAGGAAACAGGTTCAGAAAGG - Intronic
922802083 1:228369022-228369044 AGGAGGAGACAGGTTCAGGGAGG - Intronic
922802207 1:228369620-228369642 ATGGGGATCCAGGCTCAGGCTGG - Intronic
922944266 1:229497581-229497603 ATGAGGAAGCACCCTCAGCAAGG - Intronic
922953848 1:229582462-229582484 GTGAGCCAACAGGCTCAGGGAGG + Intergenic
924054360 1:240111184-240111206 ATGAGGAAACAGGATTACCAGGG + Intronic
924615885 1:245611749-245611771 ATGAGGCTGCAGGCTGAGGAGGG - Intronic
924736417 1:246761038-246761060 AGGAGGAAAGAAGGTCAGGATGG - Intronic
924934756 1:248758505-248758527 ATAAGGAAACAGGCCCAGGGAGG + Intergenic
1063448184 10:6133479-6133501 GTGAGGAAACAGGTGGAGGAAGG + Intergenic
1063451640 10:6154117-6154139 AGGTGGACACAGGCTTAGGAAGG + Intronic
1063604372 10:7509272-7509294 ATGGGCAAACAGGCTCAGAGAGG + Intergenic
1063653403 10:7962987-7963009 ATTAGGAAACAGGCTCAGAGAGG + Intronic
1063676670 10:8146455-8146477 GTGAGATAACAGGCTCAGGATGG - Intergenic
1064110665 10:12535908-12535930 ATGAGGACACAGGCTCAGAGGGG + Intronic
1064123128 10:12636647-12636669 ATGAGGAAACAGACTGAGAGGGG + Intronic
1064443391 10:15372280-15372302 ATGAGAAAAGAGGCTAAAGAGGG + Intergenic
1064681307 10:17813101-17813123 ATGAAGCACCAGGCTCAGGGAGG + Intronic
1064806887 10:19145345-19145367 AAGAGAAGACAGGCTCAGGCTGG + Intronic
1064893354 10:20205806-20205828 ATGAGGAAACAGGCTTAGAAAGG + Intronic
1065155267 10:22863001-22863023 ATGAGGAAACAGGGTCAGAGGGG + Intergenic
1065538278 10:26735754-26735776 ATAAGGAAACAGTCTTAGCAAGG - Intronic
1066482296 10:35808757-35808779 ATGAGGTATGAGGCTCTGGAGGG - Intergenic
1067166440 10:43869549-43869571 ATGAGGAGAGAGGCTCACAATGG - Intergenic
1067410760 10:46062402-46062424 ATGAGGAAACAGGTGCAAAAAGG - Intergenic
1067573566 10:47389125-47389147 AGGAGGAAACTGGCTCAGAGAGG + Intergenic
1067661558 10:48239818-48239840 ATGAGGAAACAGATTCAGAGAGG - Intronic
1067694507 10:48524785-48524807 GTGAGGAAACAGTCTCAGAGGGG - Intronic
1068703124 10:60041494-60041516 ATGAGGAAACAGGCCCAAAGTGG - Intronic
1068917757 10:62451306-62451328 ACAAGGAAACAAGCTCAGGCAGG - Intronic
1069302415 10:66925213-66925235 ATGAGGAAACAGACTTGGGGAGG - Intronic
1069842106 10:71346354-71346376 ATGGGAAAACAGGCTCATGGAGG + Intronic
1069953439 10:72035318-72035340 ACCAGGAAACAGGCTCGGAAGGG - Intergenic
1070297336 10:75173901-75173923 ATGAGGAAACTGGCTTAGAGAGG - Intronic
1070371236 10:75784239-75784261 GTGAGGAAACAAGCTCAGGGAGG - Intronic
1070576998 10:77686968-77686990 GGGAGGAAGCAGGCTCAGTATGG - Intergenic
1070748800 10:78951682-78951704 AAAAGGAAACAGCCTCAGGGAGG + Intergenic
1070758456 10:79008185-79008207 AGGAGTAAACAGACTCAGGGTGG - Intergenic
1070791592 10:79192730-79192752 ATGAGGATGCAGGCTCAGGAAGG + Intronic
1070931843 10:80266342-80266364 AGGAGGAAACAGGCTCTGGCAGG - Intergenic
1071144361 10:82550317-82550339 ATGAGAAAACATGTTCAGCAAGG + Intronic
1071162985 10:82772993-82773015 ATACGGAAACAGGCTCTGCAGGG - Intronic
1071492980 10:86148895-86148917 GTGAGGAAATAGGCTCAGAGAGG - Intronic
1071701119 10:87937654-87937676 ATGATCAAACAGGCACAGGAAGG + Intronic
1071717010 10:88107159-88107181 AAGAGGAAACATGCTCAGATAGG + Intergenic
1071840843 10:89469739-89469761 ATGAGGAAATAGCAGCAGGAAGG - Intronic
1071873073 10:89816172-89816194 GTGAGGACACAGCCTCAGGAAGG + Intergenic
1072085356 10:92073759-92073781 ATGAGCAGCAAGGCTCAGGAAGG + Intronic
1072126609 10:92451150-92451172 AGGTGGAAATAGGCTCAGAAAGG - Intergenic
1072456413 10:95580198-95580220 CTGAGGAATCAGGCTGAGGCTGG - Intergenic
1072553308 10:96495219-96495241 CTCAGGAAACAGGCTGAGGTGGG + Intronic
1072798879 10:98377964-98377986 ATGAAGAAAGAGGGTAAGGAAGG - Intergenic
1073082300 10:100867929-100867951 ATGAGGAAACGGGCTCAGTGAGG + Intergenic
1073134091 10:101210277-101210299 ATGAGGAAACTGGCTTAGCGAGG + Intergenic
1073322752 10:102625666-102625688 TGGAGGAAACAGGCACAGGCAGG - Intronic
1073540023 10:104310576-104310598 ATAAGGAAACAGGCACTGAAGGG - Exonic
1073911975 10:108356683-108356705 GTGAGGAAACAGGTTCAGATGGG - Intergenic
1074129784 10:110563791-110563813 ATGAGGAAACAGGCTTCAGGAGG + Intergenic
1074438623 10:113455622-113455644 ATGGGGAAACAGACTCAGGATGG - Intergenic
1074525250 10:114257496-114257518 ATGAGGGAACAGGCTCAGAGAGG + Intronic
1074540150 10:114358428-114358450 ATGAAGAAACAGACTCAGGGAGG + Intronic
1074541635 10:114370040-114370062 ATGGGGAAACAGAGTCAGGGAGG - Intronic
1074786182 10:116843523-116843545 GTGAGGAAATGGGCTCAGAAAGG + Intergenic
1074811241 10:117107238-117107260 ATGAGGAAACAGTTTTGGGACGG + Intronic
1074882317 10:117668619-117668641 ATGAGGGAACAGTCTCAGACAGG + Intergenic
1074936677 10:118188674-118188696 ATGAGGAAAGATGATCAGGAGGG + Intergenic
1075220078 10:120576977-120576999 AAGAGGAAACTGGCTCACAAGGG - Intronic
1075334618 10:121599076-121599098 ATAAGGAAACAGGATCAGAGAGG + Intergenic
1075686301 10:124367463-124367485 ATCAGGAAACAGGCTCAGAGAGG + Intergenic
1075733248 10:124648690-124648712 ATGAGCAAACAGGCTCAGAAAGG + Intronic
1076113509 10:127879518-127879540 ATGAGGAATGAGGCTCAGAAAGG - Intronic
1076352432 10:129826186-129826208 CTGAGGACAAAGACTCAGGAGGG + Intergenic
1076653433 10:132005549-132005571 AGGAGGACAGAGGCTGAGGATGG + Intergenic
1077146887 11:1050450-1050472 ATGAGGAAACAGGCACAGAGAGG + Intergenic
1077506370 11:2931635-2931657 AAGAGGAAACTGGTTCAGGATGG + Intergenic
1078267496 11:9766017-9766039 ATGAGGAAATAGGCTCAGACAGG + Intergenic
1078655426 11:13234523-13234545 AGGAGAAAACAGGCTCAGAGAGG + Intergenic
1078713132 11:13814262-13814284 ATGAAGAAAGAGGCCCACGAAGG - Intergenic
1078746211 11:14117872-14117894 ATAAGGAAACAGGCTCAGGGAGG - Intronic
1078819750 11:14866043-14866065 ATGAGGAAACTGGCACAGAGAGG - Intronic
1079015338 11:16863855-16863877 ATCAGGAAAGAGGCTTAGAAGGG + Intronic
1079075573 11:17383583-17383605 ATGAGGACACAGGGTCAGAAAGG - Intergenic
1079138889 11:17794448-17794470 ATGAAGAACCAGGCTCAGAGAGG + Intronic
1079139536 11:17798865-17798887 ATGAGGAAACAGGCTGGGAGAGG + Intronic
1079238250 11:18704773-18704795 ATGAGAAAACAGGCTCAATGAGG + Exonic
1079257820 11:18847716-18847738 ATGAGGAGGGAGGGTCAGGATGG + Intergenic
1079322169 11:19460352-19460374 ATGTGAAAAGAGGCTCAGGGAGG - Intronic
1079324536 11:19480333-19480355 AGGAGGAAACAGGCTTAGAGAGG + Intronic
1079401999 11:20113179-20113201 ATGAGGAAATAGGCCCAGGGAGG - Intronic
1079494476 11:21026268-21026290 AGGAGGAGACAGGATCAGGGAGG - Intronic
1079504248 11:21135566-21135588 ATAAGGAAACAGGCTCAGATGGG - Intronic
1079504415 11:21137385-21137407 AGGATCATACAGGCTCAGGAGGG + Intronic
1079975051 11:27080630-27080652 ATAAGGACACAGACTCAGGCAGG + Intronic
1080113397 11:28595168-28595190 ATGAGGAGACAGAATCAGAATGG - Intergenic
1080582788 11:33657485-33657507 ATGAGGAAACAGGCTTGGAAAGG + Intronic
1080623402 11:34006754-34006776 ATGAGGAAACAGCCTTAGTGAGG - Intergenic
1080691296 11:34560757-34560779 ATGAGGAAACAGACTCAGGCAGG + Intergenic
1080804033 11:35635578-35635600 ATGGGGAAACAGGCACAGAGTGG + Intergenic
1081207024 11:40288126-40288148 ATAAGCAAACAGGCTCAGAGAGG + Intronic
1081637463 11:44729943-44729965 CGGAGGAAGCAGGCTCAAGAGGG - Intronic
1081678048 11:44982442-44982464 AGGAAGAAAAAGGCTCTGGACGG - Intergenic
1081715015 11:45243974-45243996 ATGAGGAAAGGGGCACAGAAAGG + Exonic
1081745321 11:45468768-45468790 ATGAGGAAACAGCCACAGAGAGG + Intergenic
1082007103 11:47425551-47425573 ATGAGGAGACAGGCCCAGAGAGG - Intronic
1082015709 11:47485074-47485096 ATGAGGAAACAGGCACAGAATGG - Intronic
1082092030 11:48098017-48098039 TTGAGGAAAAAGGCCCAGAAAGG - Intronic
1082740065 11:56901008-56901030 ATGAAGAAACAGACTCACAAAGG + Intergenic
1082806496 11:57454984-57455006 ATGGAGAAACAGGCTCAGAGAGG - Intergenic
1082997358 11:59264572-59264594 ATGAAGAAACAGGCTCAGGTGGG - Intergenic
1083158719 11:60841678-60841700 ATGAGAAAACAGGCCCAAGGAGG + Intergenic
1083222666 11:61263728-61263750 GTGAGAAAACAGGCCCAGGCAGG - Intronic
1083315550 11:61812915-61812937 ATGAGATAACAGGCTCAGGGAGG - Intronic
1083430226 11:62610613-62610635 GTGAGGAAGCAGGCTCAGAGAGG - Intronic
1083488963 11:63000877-63000899 ATGAGGCCACAGGCTGAGCATGG - Intronic
1083658184 11:64240309-64240331 TTGAGGAAATAGGCTCAGAAAGG + Intergenic
1083774862 11:64889448-64889470 AGGAGGACACAGGCTCAGAGAGG - Intergenic
1083786695 11:64953238-64953260 GTAAGGAAACAGACTCAGGGAGG + Intronic
1083793993 11:65003982-65004004 ATGAGGAAACAGGTCCAGAGAGG - Intergenic
1083935801 11:65869527-65869549 AAGAAGAAACAGGCTCAGAGAGG + Intronic
1084041234 11:66543828-66543850 ATGAAGCAGCAGGCACAGGAAGG + Exonic
1084079962 11:66815901-66815923 ATAGAGAAACAGGTTCAGGAGGG + Intronic
1084112389 11:67022698-67022720 ATGAAGAAACAGGCTCAGAGAGG - Intronic
1084155161 11:67309190-67309212 ATGGGGAAACAAGCCCAGCAGGG + Intronic
1084180902 11:67445344-67445366 TTGAGGAAACAGGCACAGAGAGG + Intergenic
1084285110 11:68126011-68126033 ATGAGGAAAGTGGCTTAGAAAGG - Intergenic
1084322888 11:68383541-68383563 ATGAGGAGACAGGCCCAGAGAGG + Intronic
1084344758 11:68539278-68539300 ATGAGGAAACAGACCCAAGAAGG - Intronic
1084373131 11:68757999-68758021 ATGAGCCACCATGCTCAGGATGG - Intronic
1084684722 11:70686871-70686893 ATGAGGAGACTGGTTCTGGAGGG - Intronic
1084775597 11:71372616-71372638 AAGAAGAAACAGGCCCTGGAGGG + Intergenic
1084881211 11:72172891-72172913 ATGAGGAAATAGGCCCAGAGAGG + Intergenic
1084949477 11:72656826-72656848 ATGGGGAAACAGGCCCAGGGTGG - Intronic
1084965522 11:72742408-72742430 ATTAGGAAACAGCCTCAGAGAGG + Intronic
1085056001 11:73404306-73404328 ATGAGGAAACAGGTTATGGAAGG - Intronic
1085114120 11:73915110-73915132 ATGAGGAAGCAGGCTCAGAGAGG - Intronic
1085148463 11:74226290-74226312 ATGAGGAAACTGGCTCATATAGG + Intronic
1085193019 11:74645571-74645593 ATGAGGAAACAAGTTCAGAGAGG - Intronic
1085245347 11:75096755-75096777 ATGGGGAGATAGGCTCAGGGAGG - Intergenic
1085294895 11:75425765-75425787 GAGAGGAAACCGGCTCAGGGAGG - Intronic
1085392286 11:76188675-76188697 ATGGGGAAACAGACACAGAAGGG + Intronic
1085419190 11:76341080-76341102 ATGAGGAGACAGGCCCAGAGAGG + Intergenic
1085462020 11:76699923-76699945 ATGAGGATGCAGGCACAGGGAGG - Intergenic
1085465911 11:76723225-76723247 ATAAGGAGACAGGCACAGAAAGG + Intergenic
1085520117 11:77132816-77132838 ATGATGAAACAGGCTCAGGAAGG + Intronic
1085557719 11:77440503-77440525 ATGAGGAAACAAACTGAGAAAGG + Intronic
1085604306 11:77883463-77883485 ATAAGGAAAAAGACTCAGAAAGG + Intronic
1085721883 11:78919640-78919662 AAAGGGAAACAGGGTCAGGAGGG + Intronic
1085811388 11:79685303-79685325 GTGAGGAAACAGGCTGAAGAAGG + Intergenic
1086005813 11:82034181-82034203 ATGAGAAAACACACTCAGGCAGG + Intergenic
1086369744 11:86144471-86144493 ATGAGAAAACTGGTTCAGAAAGG + Intergenic
1087104552 11:94396843-94396865 ATGAGGAAACAGATTCAGAGAGG - Intronic
1087152807 11:94873590-94873612 ATGAGGAAATGGGCTCAGAAAGG + Exonic
1087175843 11:95094249-95094271 AGGAGGAAACTGGCTAAGGGAGG + Intronic
1087176238 11:95098770-95098792 AGGAGGAAACAGGCCCAGAGAGG + Intronic
1087292747 11:96338374-96338396 ATGAAGAAACTGGCTGAGTAAGG + Intronic
1087411514 11:97795907-97795929 ATAAGGAAACAGGCTTAGTGGGG + Intergenic
1087614675 11:100474294-100474316 ATGACGAAGCATGCACAGGAAGG + Intergenic
1087838985 11:102903421-102903443 AGGAGGAAACAGGCACAGAGAGG - Intergenic
1087854595 11:103076585-103076607 ATGAGGAAACAGGCTGAAAACGG - Intronic
1087884955 11:103469100-103469122 ATGAGGAAACGTGCTCACGCAGG + Intronic
1088392162 11:109326492-109326514 ATGAAGAAACAGTCCCAGAAAGG - Intergenic
1088530226 11:110800081-110800103 ATGGGGACACAGGCTCTGGGTGG + Intergenic
1088581764 11:111323514-111323536 TTTAGGAATCAGGCTCCGGAGGG - Intergenic
1088632276 11:111785208-111785230 ATAAGGAAACAGGCTGCGGGTGG - Intronic
1088718812 11:112573935-112573957 ATGAGAAAACAGTCTCAGACAGG - Intergenic
1088811731 11:113396892-113396914 ATGAGATCACAGGCTGAGGATGG + Intronic
1088971828 11:114780672-114780694 ATGCTGTAAGAGGCTCAGGAAGG + Intergenic
1089338222 11:117740249-117740271 ATGAGAAAACAGGCTTAGAGAGG + Intronic
1089399322 11:118155353-118155375 ATGAAGAAAGAGGCTCAGAGAGG + Intergenic
1089466809 11:118690869-118690891 ATGAGCAAAGTAGCTCAGGACGG - Intergenic
1089497912 11:118916979-118917001 CTGAGCAAACAGCCTCAGGGAGG + Intronic
1089710217 11:120309231-120309253 ATGACAAGACAGGCTCAGAAAGG + Intronic
1089784411 11:120897810-120897832 ATGAGAAAACATGCTCAGAGAGG + Intronic
1089854743 11:121533301-121533323 ATGAGAAAACAGGCTCAGCAAGG + Intronic
1089996561 11:122913478-122913500 ATGAGGCTACAGGAGCAGGAAGG - Intronic
1090452420 11:126818444-126818466 GTGAGGAAATAGGCTCAGAGAGG - Intronic
1090803616 11:130189414-130189436 GTCAGAAAACAGGCTCAGGAAGG + Intronic
1090978500 11:131695817-131695839 TTGAGGAAAGAGGCTCAGAGAGG + Intronic
1091136222 11:133192658-133192680 AAGAGGAAACAGACTCAAGGAGG - Intronic
1091303894 11:134524381-134524403 ATGGGGAACAAGGTTCAGGAGGG - Intergenic
1091371900 11:135067619-135067641 ATAAGGAAACAGACTCTGAAAGG + Intergenic
1091538316 12:1434811-1434833 ATGACGAAAGAGGCTCAGCATGG - Intronic
1091563761 12:1633061-1633083 ACGAGGAAGCAGGCTCTGGGAGG + Intronic
1091839716 12:3612087-3612109 ATCAGGCAACAGGCACTGGAAGG + Intronic
1091854424 12:3727939-3727961 ATGAGGAAACAGGCCCAAGAGGG + Intronic
1091935116 12:4428824-4428846 ATGGGGAAATTGGCCCAGGAGGG - Intronic
1091998652 12:5015651-5015673 ATGAGAAAACAGGCACAGAAAGG - Intergenic
1092141096 12:6183942-6183964 ATGAGGAGGCAGGCTCAGAGAGG + Intergenic
1092145554 12:6212252-6212274 ATGAAGAAACAGGCTCCGAGAGG - Intronic
1092158932 12:6304646-6304668 GGGAGGAAACAGGCTCAGAGAGG - Intergenic
1092242218 12:6842215-6842237 TTGAGTAAACAGACTCAGGGAGG + Intronic
1092248141 12:6874942-6874964 AGGAAGAAACAGGCACAGGGAGG - Intronic
1092302593 12:7266317-7266339 ATGAGGAAACAAGCTCTGAGAGG - Intergenic
1093051094 12:14505934-14505956 ATGAGGAAACAGAAACATGACGG + Intronic
1093483635 12:19629778-19629800 ATGAAGAAACAATCTCAGGGAGG + Intronic
1093707393 12:22289330-22289352 CTGAGGAAACAGGCTTAGAGCGG + Intronic
1094461426 12:30700582-30700604 ATGAGGAAACAGGCACAGAGAGG - Intergenic
1094486971 12:30933240-30933262 AGGAGGACACTGGCTCAGGTAGG + Intronic
1094489902 12:30953435-30953457 ATGAGGAAGCAGGCCCAGACAGG - Intronic
1094535510 12:31319208-31319230 ATGAGGAAACAGGATTAGTGAGG - Intronic
1094697691 12:32837351-32837373 ATGAGGAAACAGCCTCAGAGAGG - Intronic
1095537896 12:43273628-43273650 GTGAGGAAAGAGACTCAGAAAGG - Intergenic
1095619329 12:44230169-44230191 ATAAGGAAACAGGCTTAGAGTGG + Intronic
1095704995 12:45227477-45227499 CTGAAGAAACAGGCTCAGAGAGG - Intronic
1095817273 12:46438305-46438327 ATGAGGAAACTGGCTCAGAGAGG + Intergenic
1096194198 12:49638770-49638792 ATGAGGAAACAGGGTCAGAAAGG - Exonic
1096410839 12:51376180-51376202 AAGAGGAAACAGGTTCAGGGAGG + Intronic
1096464378 12:51840233-51840255 AAGAGGAGACAGGCACTGGAAGG - Intergenic
1096613728 12:52819729-52819751 ATAAGAAAACAGGTTGAGGAAGG - Intergenic
1096738009 12:53671262-53671284 ATGAGAATACAGGCTTAGAAAGG - Intronic
1096828409 12:54296550-54296572 ATGAAGATACAGGGGCAGGAGGG - Intronic
1097018131 12:56001635-56001657 ATGAGGAAGCAAGTTCAGAACGG + Exonic
1097187407 12:57203147-57203169 AGGGGGAGACAGGCCCAGGAGGG - Intronic
1097238215 12:57554258-57554280 ATGACGAAACAGGCTCAAAGAGG - Intronic
1097442679 12:59630430-59630452 ATGAGGAAACAGCCTCAAAGAGG - Intronic
1097723752 12:63051142-63051164 GTGAGGAAACAGCCTCAGAGAGG + Intergenic
1097880409 12:64681403-64681425 ATGAGGGAACAGGCTCAGAAAGG + Intronic
1098133981 12:67382091-67382113 ATGAGAAAAAAGGCCCAGGGAGG + Intergenic
1098448223 12:70589503-70589525 ATGAGAAAACAGGCTCAAAGAGG - Intronic
1098655621 12:73026032-73026054 AAACGGAAACAGGCTCAGCAAGG - Intergenic
1099076882 12:78120734-78120756 ATGAGAAAACAGACTCAGAGAGG - Intronic
1099220762 12:79911291-79911313 AAGAGGAGAGAGGCTGAGGAAGG - Intronic
1099300812 12:80892321-80892343 TTGATGAGACTGGCTCAGGAAGG + Intronic
1099602315 12:84756749-84756771 ATGAGGAAACTGGATGATGATGG - Intergenic
1099821675 12:87719329-87719351 ATGAAGAAACAGACTCAGAAAGG - Intergenic
1100119904 12:91357611-91357633 ATGAGGAAATAGCCTCTTGATGG - Intergenic
1100150959 12:91737057-91737079 ATGAGGAAACAGGTTTAGGGAGG - Intergenic
1100269881 12:93014543-93014565 AAGAGGAGACAGTGTCAGGAGGG + Intergenic
1100278074 12:93090336-93090358 TTGAGGAAACAGGTTCAGAGAGG - Intergenic
1100467486 12:94859712-94859734 AGGAAGAAAGAGGGTCAGGAAGG - Intergenic
1100769583 12:97906839-97906861 GTCAGCAAACAGGCTCAGGGAGG + Intergenic
1100826398 12:98478759-98478781 ATGATGAAACAGGCTTACGAAGG + Intergenic
1101041412 12:100759737-100759759 ATGGGGAAACGGGCTCAAAATGG - Intronic
1101109080 12:101468191-101468213 ATGAAGAAACAGGCTCAGGGAGG - Intergenic
1101241114 12:102841100-102841122 ATGAGGAAACAGGCTTGGGAAGG + Intronic
1101314729 12:103618702-103618724 ATGAGGAAACAGGCACAGAGTGG - Intronic
1101320333 12:103668012-103668034 ATAAGGAAACAGGCCCAGACAGG - Intronic
1101448170 12:104753137-104753159 ACGAGGAAACAGGCTGAGACAGG - Intronic
1101541138 12:105666548-105666570 ATGAGGAAACAGACATAGAAAGG + Intergenic
1101708233 12:107240769-107240791 GTGAGGAAAGAGGCTCAAGTGGG - Intergenic
1101720425 12:107345994-107346016 GTGAGGAAGCAGACCCAGGAAGG + Intronic
1101739630 12:107490922-107490944 ATGAGAAAAGAGGCTCAGAGAGG + Intronic
1101777487 12:107807504-107807526 ATGAGAAAACAGTCTCAGGGGGG + Intergenic
1101823235 12:108200308-108200330 ATGAAGAAACAGGCTCAGAGAGG + Intronic
1101840319 12:108323397-108323419 ATGTGGACACAGGCTCCGGTGGG + Intronic
1101846668 12:108368358-108368380 ATGGAGAAACAGGCCCAGAAGGG + Intergenic
1101923944 12:108955884-108955906 ATGAGAAAACAGATGCAGGAAGG + Intronic
1102041413 12:109803258-109803280 ATGAGGAAACAGGCTTGGAGAGG - Intronic
1102182609 12:110923753-110923775 GTGAGGAAACAGGCCCGAGAGGG - Intergenic
1102195717 12:111023877-111023899 CTGAAGAAACAGGTTCAGGCAGG + Intergenic
1102210579 12:111123894-111123916 ATAAGGAAACAGGCTCAGAGGGG + Intronic
1102246584 12:111360489-111360511 ATGTGGAAACAGGCTCACTGAGG - Intergenic
1102475771 12:113187153-113187175 ATGAGTAAACTGGCTCAGAGAGG - Intronic
1102481773 12:113228704-113228726 AGGAGGAGACAGGCTCAGAGAGG + Intronic
1102502274 12:113360566-113360588 ATGAGGGAACATGCTCAGAGAGG - Intronic
1102570555 12:113824736-113824758 TTGAAGAAACAGGCTCAGAGAGG - Intronic
1102602241 12:114040152-114040174 ATCAGGAAAAGGGCTCAGGAAGG + Intergenic
1102802888 12:115751930-115751952 GTGAGGAAACAGTCTCAGAGAGG - Intergenic
1102956243 12:117060938-117060960 ACGAGAAAACAGACTCAGGAAGG - Intronic
1103038949 12:117678858-117678880 ATGAGGAGACAGGCCCAGAGAGG - Intronic
1103181408 12:118915117-118915139 AAGAAGAAACAGGCTCTGAAAGG + Intergenic
1103191751 12:119007634-119007656 ATGAGGAAACAAACTCAGAGAGG + Intronic
1103201000 12:119087896-119087918 ATGAGAAAACAGGCTCAGAGAGG - Intronic
1103326621 12:120125713-120125735 AAGAGGAAACCGGCCCAGGGAGG + Intergenic
1103415394 12:120739268-120739290 ATGAGAACAGTGGCTCAGGAGGG - Intronic
1103515994 12:121508734-121508756 ATGAGGAAGTAGGCTCAGAGAGG - Intronic
1103538382 12:121649347-121649369 AGGAGGAAACAGGTTCAGGGAGG - Intergenic
1103719974 12:122968308-122968330 ATGAGAAAACAGGCTCAGATAGG - Intronic
1103922209 12:124404925-124404947 AGGAGGAAACAGGCTCAGAGAGG + Intronic
1104243113 12:127010656-127010678 ATGAGAAAACAGGCTTAAAATGG - Intergenic
1104360919 12:128132482-128132504 ATGGGGAAACAGGCTCAGAGAGG + Intergenic
1104397518 12:128447178-128447200 AAGTGGACACAGGCGCAGGAGGG - Intronic
1104440202 12:128787963-128787985 ATGAGGTCACAGGTTCTGGATGG + Intergenic
1105311944 13:19219927-19219949 ATGAAGAAACGTGCTCAGAAAGG - Intergenic
1105699924 13:22927834-22927856 AGGAGGTCACAGGCTCAGGCTGG + Intergenic
1105706102 13:22968237-22968259 ATCAGGATTCAGGCTCAGGCTGG - Intergenic
1106193472 13:27474139-27474161 ATGAAGAAACAGGCCCAGACAGG + Intergenic
1106301246 13:28468156-28468178 ATGAGGAAACTGGTTCAGAAAGG - Intronic
1106373044 13:29155544-29155566 ATGAAGAGGCAGGCTCAGGATGG + Intronic
1106999782 13:35529156-35529178 ATGAGGACACAGGCTCAGACAGG + Intronic
1107061390 13:36163201-36163223 AAGAGGAAACAGGCGCAAAAAGG + Intergenic
1107708550 13:43130918-43130940 CTGAGGAAAGAGGCTGAGCAGGG + Intergenic
1108000784 13:45904105-45904127 ATGAGGAAACAGGCTTAGAGAGG - Intergenic
1108195618 13:47991589-47991611 ATCAGAAAAGAGGCCCAGGAGGG + Intronic
1108410085 13:50136993-50137015 TTGAGGAAACAAGCCAAGGAGGG - Intronic
1108486200 13:50928738-50928760 ATGTGGAAACAGCCACAGGAAGG + Intronic
1108620749 13:52181718-52181740 CTGGGGAAACAGGCTGATGAAGG + Intergenic
1108739191 13:53317663-53317685 ATGAGGAAAAAGGCTCAGAGAGG + Intergenic
1109225734 13:59692592-59692614 ACAAGGAAACAGGCCCAGAATGG + Intronic
1109313642 13:60724472-60724494 TGGAAGAAACAGCCTCAGGAGGG + Intergenic
1110053056 13:70928545-70928567 ATGTGGAAAGAGGTTAAGGATGG - Intergenic
1110235156 13:73210123-73210145 ATAAGGAAACAGGCACAGAGAGG - Intergenic
1110711656 13:78657088-78657110 ATAAGGAAACAGGCTCAAAAAGG - Intronic
1112461594 13:99607633-99607655 ATGAAAAAACAGGGTCAGAAAGG + Intronic
1112579946 13:100669892-100669914 TTGAGGAAACAGGCCCAGAGAGG - Intronic
1112826362 13:103397155-103397177 ATGGTGAAACAGGCACAGAATGG + Intergenic
1113243110 13:108362028-108362050 GAGAGGAAACAGGTGCAGGATGG + Intergenic
1113252067 13:108464460-108464482 ATGAGGTAACAGTCTCAGAAAGG + Intergenic
1113896202 13:113766064-113766086 GTGAGGGCTCAGGCTCAGGAGGG - Intronic
1114424602 14:22611511-22611533 AGGAGGAAACAGGCCAAGGCAGG + Exonic
1114535305 14:23418676-23418698 AGAGGGAAACAGGCTCAGAAAGG + Intronic
1115408644 14:33047821-33047843 CTGAGAAAACTGACTCAGGAAGG - Intronic
1115631173 14:35247044-35247066 ATGATGAAACAGGCTCAGAGAGG + Intronic
1115736037 14:36331009-36331031 ATAAGGAAACAGGCACAGAGAGG - Intergenic
1115976751 14:39005269-39005291 TTCTAGAAACAGGCTCAGGAGGG - Intergenic
1116539005 14:46074282-46074304 ATGAGGAAACTGCCTCAGAGAGG - Intergenic
1117009366 14:51454564-51454586 ACCAGGAAGCAGCCTCAGGAAGG - Intergenic
1117019094 14:51550822-51550844 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1117156768 14:52950338-52950360 GGGAGGAAAGAGGCTCACGACGG - Intronic
1117642320 14:57813063-57813085 ATGAGGAAACAGGCACAGAGAGG + Intronic
1118506062 14:66413295-66413317 ATAAGGAACCAGGCTCAAAAGGG + Intergenic
1118671405 14:68132009-68132031 AGGAAGAATCAGGCTCAGAAAGG + Intronic
1118735198 14:68696102-68696124 AAGAGGAAACAGGCTGAGAGAGG - Intronic
1119201402 14:72755495-72755517 GTGAGGCAATAGGCTCAGAAAGG - Intronic
1119379015 14:74217063-74217085 ATGAGGAAACAGGCTAGAAAAGG + Intergenic
1119432526 14:74577859-74577881 ATGCGGGAACAAGCCCAGGAAGG + Intronic
1119449698 14:74698731-74698753 ATGAGTAAGCAGGCTGAGCATGG + Intronic
1119473602 14:74914069-74914091 ATGGAGAAACAGGCTCAGGAGGG - Intronic
1119613807 14:76085132-76085154 ATGAGGAAACAGACTCAGAGAGG + Intergenic
1119614138 14:76087309-76087331 ATTAGAAAACAGGATCAGAAAGG - Intergenic
1119653510 14:76400135-76400157 ATGAGGTACCAGGAGCAGGAGGG - Intronic
1119697976 14:76729168-76729190 ATGAGCAAACAGACTCAGTTTGG - Intergenic
1119726605 14:76925212-76925234 ATGAAGACACAGCCTCAGAAAGG - Intergenic
1119739921 14:77007746-77007768 AAGAGAAAACAGGCCCAGAAAGG - Intergenic
1119788273 14:77328487-77328509 ATGAGGAAATAGCCCCAGAAAGG + Intronic
1120674391 14:87404057-87404079 ATAACGAAATAGGCTCAGAAAGG + Intergenic
1120879715 14:89405589-89405611 ATGAGGCAGGGGGCTCAGGATGG + Intronic
1120932170 14:89859767-89859789 CAGAGGAAACAGGCAGAGGAGGG + Intronic
1121181727 14:91934280-91934302 ATGAGAAAACAGGCTCAGTGAGG - Intronic
1121246121 14:92462048-92462070 AGGCGGAAACAGGCTCAGAGAGG + Intronic
1121419457 14:93802509-93802531 ATGAGGAAACAGGCCAAGGGAGG + Intergenic
1121495480 14:94389047-94389069 ATGAGGAAACAGGCTCAGAGCGG + Intronic
1121562384 14:94885067-94885089 AGGAGGACACAGGGTGAGGAAGG - Intergenic
1121572897 14:94960929-94960951 ATGAGAAAACAGGCACAGAGAGG - Intergenic
1121576041 14:94988709-94988731 AAGAGGAAACAGACTCAGAGAGG - Intergenic
1121654657 14:95586501-95586523 ATGTGGTCACAGGCTGAGGAAGG + Intergenic
1121683664 14:95815582-95815604 GTGAGGAAACCGACTCAGGGAGG - Intergenic
1121744892 14:96280342-96280364 ATGAGGAGACAGGTTCAGAGAGG - Intergenic
1122045205 14:99018009-99018031 ATGAGGAAACAGGCTCAGCAAGG - Intergenic
1122136248 14:99634666-99634688 ATAAGGAAACGGGCTCAGCCAGG + Intergenic
1122334550 14:100962039-100962061 ATGTGAAAAAAGGCTAAGGAAGG + Intergenic
1122666006 14:103330148-103330170 GTGAGGAAAGAGACTCAGGAAGG - Intergenic
1122855478 14:104557950-104557972 AGGAGGAACCAGGCTCAGCTGGG + Intronic
1123016442 14:105377819-105377841 ATGAGGCCACAGCCTCGGGATGG - Intronic
1123101857 14:105808868-105808890 AGGAAGAAAAAGGCTAAGGAAGG - Intergenic
1123129242 14:105972329-105972351 ATGAGGTAACAGTCCCAGGGCGG + Intergenic
1123409761 15:20048496-20048518 ATGAGGTAACAGTCCCAGGGAGG + Intergenic
1123519093 15:21055204-21055226 ATGAGGTAACAGTCCCAGGGAGG + Intergenic
1123722706 15:23073873-23073895 ATGAGGACACAGGCTCACAGAGG - Intergenic
1123861876 15:24477091-24477113 GTGAGGAAGCAGGAGCAGGAAGG + Intergenic
1123871730 15:24581700-24581722 ATGAGGAGGCAGGAGCAGGAAGG + Intergenic
1123899558 15:24862913-24862935 ATGAGGAGGCAGGAGCAGGAAGG + Intronic
1123947868 15:25247636-25247658 GGGAGAAAGCAGGCTCAGGAAGG - Intergenic
1124444475 15:29717659-29717681 GTGAGGAAACAGACTCAGATTGG - Intronic
1124449177 15:29769926-29769948 CTGAGAAAACAGCCTCAGGTAGG + Intronic
1124490891 15:30154559-30154581 ATGGGGAAACAGGTTCAGAGAGG + Intergenic
1124625867 15:31307199-31307221 ATGGGGAAACAGGCTCAGAGAGG + Intergenic
1124752642 15:32383772-32383794 ATGGGGAAACAGGTTCAGAGAGG - Intergenic
1125430359 15:39587676-39587698 ATGAGGAAAGAGCCTCAGAGAGG - Intronic
1125588840 15:40842262-40842284 ATGAGCAAACAGGCTCAGACAGG - Intergenic
1125881834 15:43202055-43202077 ATGAGGAAACTTACTGAGGAGGG - Intronic
1126105545 15:45144744-45144766 AAGAGGAAAGGGGCTCAGTAGGG - Intronic
1126109221 15:45166043-45166065 ATGAGAAAACAGGCCCAGAGAGG - Intergenic
1126367776 15:47913764-47913786 CCTAGGACACAGGCTCAGGAGGG - Intergenic
1126403315 15:48296647-48296669 ATGAGGAACAAGGATGAGGAAGG + Intronic
1126407619 15:48337433-48337455 ATGAGGAAACAGGCTCAGAAAGG - Intronic
1126451027 15:48809943-48809965 ATGGGGGAACAGGCTTGGGAGGG - Intronic
1126499714 15:49332029-49332051 ATGAGGAAACAGGCTGAGATAGG + Intronic
1126644868 15:50865437-50865459 ATGAAGAAACAGCCTCATAAAGG + Intergenic
1126943075 15:53786900-53786922 ATAAGGAAACAGGCTCACAGAGG + Intergenic
1126953498 15:53909429-53909451 ATGAGGAGACAGGCTCAAGAAGG + Intergenic
1127717571 15:61664461-61664483 ATGAGGAAACCAAGTCAGGAAGG + Intergenic
1127764149 15:62168300-62168322 ATGCAGAAACAGGCTCACAAAGG + Intergenic
1127934391 15:63622621-63622643 ATGAGGAAACAGGCCAGGCATGG - Intronic
1127965700 15:63921354-63921376 CTGAGGAAACAGGGAGAGGATGG - Intronic
1127993421 15:64137229-64137251 ATGAGGCCTCAGCCTCAGGAGGG - Intronic
1128252489 15:66172802-66172824 ATGAGGAAACAGGCTCAGACAGG + Intronic
1128323932 15:66711400-66711422 CTGAGGAAACAGGCTCAGAGAGG + Intronic
1128451707 15:67809699-67809721 ATGAGGAAACAGACTCAGACAGG - Intergenic
1128485729 15:68085648-68085670 ATGAGGAGACAAGTTCAGAAAGG - Intronic
1128501062 15:68228064-68228086 ATGAGGAAATAGGCTTAGATGGG - Intronic
1128576879 15:68782360-68782382 ATGAAGAAATAGGCTCAGAAAGG + Intronic
1128652706 15:69430861-69430883 ATGAGGAAATAGGTTTGGGAAGG + Intronic
1128937476 15:71759380-71759402 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1129113963 15:73354627-73354649 ATTAGAAAACAGGCTCAGAGAGG - Intronic
1129173326 15:73821363-73821385 ATGAGGTCACAGGCTGAGGCTGG - Intergenic
1129190081 15:73932002-73932024 ATGAGAAAACAGGCCTAGGGAGG + Intronic
1129295826 15:74599526-74599548 CGGAGGAAGCAGGCTGAGGAGGG + Intronic
1129338110 15:74866158-74866180 AAGTGAAAACAGGCTGAGGAAGG + Intronic
1129456860 15:75680748-75680770 ATAAGGAAACAGGCTCGTGGAGG - Intronic
1129660428 15:77550063-77550085 ATGAGAAAACAGGCTCAGAGAGG + Intergenic
1129677544 15:77640532-77640554 GTTAGGAAACAGGATCAGGGAGG + Intronic
1129687324 15:77694337-77694359 ATGAGGAAACAGGCCCAGAGAGG + Intronic
1129700278 15:77763724-77763746 AGGAGGAGACAGGCTCAGAGAGG + Intronic
1129713380 15:77832944-77832966 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
1129817050 15:78564822-78564844 ACGAGGAAACAGGCCCAGAGAGG + Intergenic
1129820873 15:78601071-78601093 AAGAGAAAACAGGCTCAGAGAGG + Intronic
1129852061 15:78798996-78799018 ATGAGGAAACAGGCTCAGAGGGG - Intronic
1129856225 15:78827194-78827216 AGGAGGAAGCAGGCTCAGAGAGG - Intronic
1129901781 15:79157062-79157084 ATGTGGAAACAGCCTCAGAGAGG + Intergenic
1130250942 15:82300091-82300113 ATGAGGAAACAGGCTCAGAGGGG + Intergenic
1130287503 15:82568181-82568203 ATGAGGAAATAGGCTCATGGAGG - Intronic
1130551894 15:84894796-84894818 ATGAGGAAACAGGCTCAGTGAGG + Intronic
1130649817 15:85756156-85756178 CTGAGGAAACATGCTCAGCATGG - Intergenic
1130660027 15:85824059-85824081 ATGAAGAAACAGGCTGATGGAGG + Intergenic
1131032561 15:89198655-89198677 AGGAGGGAACAGGCTCAGAGAGG - Exonic
1131118251 15:89807300-89807322 ATGAGGAGAGAGGTTCAGAAGGG - Intronic
1131194671 15:90346048-90346070 GTGAGGAAACAGTCACATGAGGG + Intergenic
1131254316 15:90851967-90851989 GTGAGGAAACAGGCACAGAGTGG - Intergenic
1131463643 15:92637535-92637557 ATGTGGAAAAAGCCCCAGGAAGG - Intronic
1131864010 15:96687533-96687555 ATGAGGAAACAGGCTCAGGGAGG + Intergenic
1132153339 15:99477609-99477631 TTGAAGAAACAGGCTCAGGGAGG + Intergenic
1132259357 15:100408615-100408637 ATGATGAATCAAGCTCAGAAGGG + Intronic
1133003758 16:2865793-2865815 ATGAGGAAATTGGCTCAGAGAGG + Intergenic
1133065084 16:3200317-3200339 ATGAGGAAAAAGGCTGGGCATGG + Intergenic
1133696757 16:8271496-8271518 ATGAGGATACAGGATCAGAGAGG + Intergenic
1133757751 16:8775429-8775451 ATGAGGAATCAGGCACAGAGAGG + Intronic
1133985432 16:10664716-10664738 ATTAGGAAACAGATTCAGAAGGG + Intronic
1134022864 16:10933521-10933543 ATGAGGAAACTGGCCCAGAGAGG - Intronic
1134046495 16:11104742-11104764 ATAAGGAAACAGCCTCTGAAGGG + Intronic
1134072812 16:11271442-11271464 AAGAGGGAACAGGCTCAGAGAGG + Intronic
1134108535 16:11500537-11500559 ATCAGAAAAGAAGCTCAGGAAGG + Intronic
1134217848 16:12330239-12330261 GTGAGGAAACAGGCACAGAGAGG - Intronic
1134572425 16:15302668-15302690 GTGAAGAAACAGGCTCAGAGAGG - Intergenic
1134729957 16:16453373-16453395 GTGAAGAAACAGGCTCAGAGAGG + Intergenic
1134779559 16:16883483-16883505 AAGAGGAAACAAGCTCAGAAAGG + Intergenic
1134937476 16:18258527-18258549 GTGAAGAAACAGGCTCAGAGAGG - Intergenic
1135074763 16:19383639-19383661 ATGAGAAAACAGGCTCAGAAAGG - Intergenic
1135080916 16:19434852-19434874 TTGAGGAAACAGACTCAGAGGGG + Intronic
1135150704 16:20002840-20002862 ATGAGAAAATGGGCTCAGGGAGG + Intergenic
1135245310 16:20851455-20851477 GTGAGGAAACAGGCCCAGAGAGG - Intronic
1135510063 16:23074939-23074961 ATGCTGGAACAGACTCAGGATGG + Intronic
1135660405 16:24291720-24291742 ATGAGGAAACTGAGGCAGGAGGG - Intronic
1135662968 16:24312437-24312459 ATGAGAAAACAGGCACAGAGAGG - Intronic
1135861337 16:26058795-26058817 ATGCGGAAACAGGCCCAGAGAGG + Intronic
1135886005 16:26308628-26308650 ATGAGAAAAAAGACTCAGAAAGG - Intergenic
1136063452 16:27742614-27742636 AGGAGGAAACAGGCTCAGCAGGG - Intronic
1136071277 16:27788841-27788863 ATGAGGAAACAGGCACAGAAAGG + Exonic
1136369360 16:29826268-29826290 ATGAGGAAACAGGCACAGGGTGG + Intronic
1136392953 16:29976923-29976945 ATAAAGAAACAGGCTCAGCAAGG - Intronic
1136410474 16:30073999-30074021 AGGAGGAAACTGGCTCAGAGGGG - Intergenic
1136546163 16:30956202-30956224 ATAAGGAAACAGGCCCAAGAAGG + Intronic
1136555405 16:31004805-31004827 ACAAGGAAACAGGCTCAGAGAGG + Intronic
1136567001 16:31076604-31076626 ATGAGGACACATGCTCCTGAGGG + Exonic
1136686319 16:31996777-31996799 AGGAGGAAACAGGCTCAGAGAGG + Intergenic
1136713510 16:32259033-32259055 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1136754401 16:32670398-32670420 ATGAAAAAACAGTTTCAGGAAGG + Intergenic
1136786932 16:32940306-32940328 AGGAGGAAACAGGCTCAGAGAGG + Intergenic
1136813712 16:33199967-33199989 ATGAAAAAACAGTTTCAGGAAGG - Intronic
1136820188 16:33310047-33310069 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1136826751 16:33366586-33366608 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1136831817 16:33465357-33465379 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1136853578 16:33634291-33634313 ATAAGCAAACAGGCTCAGACTGG - Intergenic
1136882841 16:33913483-33913505 AGGAGGAAACAGGCTCAGAGAGG - Intergenic
1136997626 16:35201589-35201611 ATGAGGAAATAGTCTTAGGGAGG + Intergenic
1137010436 16:35315447-35315469 GTGAGGAAACAGTCTCAGGGAGG + Intergenic
1137024048 16:35455773-35455795 ATGAGGAAACAGTCTCAGGGAGG + Intergenic
1137400043 16:48145967-48145989 GTGAGGAAACAGGCACAGAGAGG - Intronic
1137491708 16:48938488-48938510 ATGAGGAAACAGGTTCAGAGAGG + Intergenic
1137823252 16:51465459-51465481 ATGACCAAAGAGGCCCAGGATGG - Intergenic
1137950460 16:52778854-52778876 ATGACAAAACAGACTCAGAAAGG - Intergenic
1138230714 16:55333864-55333886 ATGAGGAAATAGGCTCAGAGAGG + Intergenic
1138454131 16:57111668-57111690 ATGAGGAGACAGGTTCAGAAAGG - Intronic
1138488403 16:57361483-57361505 ATGGAGAAACAGGCTTAGCAAGG + Intronic
1138498161 16:57421316-57421338 ATGGAGAAATAGGCTCAGGCAGG - Intergenic
1138564385 16:57822229-57822251 AGAAGGAAACAGGCTCAGAGAGG - Intronic
1138589032 16:57989632-57989654 ATGATGAAATGGACTCAGGAAGG + Intergenic
1138681083 16:58684190-58684212 ATAGGAAAACAGGCCCAGGAGGG + Exonic
1139278569 16:65750267-65750289 ATGAGGAAACAGGCCCAGCAAGG + Intergenic
1139336348 16:66234416-66234438 TTGAGGAAATAGGCTCAGAGAGG - Intergenic
1139387278 16:66580748-66580770 ATGAGGAAACAGGCTGGGAATGG - Intronic
1139694488 16:68664034-68664056 CTGAGGAAACAGGCCCAGAGAGG + Intronic
1139779210 16:69336976-69336998 ATGAGGAAATAGGTTCAGAGAGG - Intronic
1139787460 16:69405366-69405388 ATGAGGCAACAGGCTCAAAGAGG + Intronic
1139969908 16:70767742-70767764 ATGAGGAAACAGACCCAGAGAGG - Intronic
1139974282 16:70796582-70796604 ATGAGGAAACAGGCTCCTTGAGG - Intronic
1140525747 16:75621454-75621476 ATGAGGAAACAGACCCAGCAAGG - Intronic
1140659298 16:77172199-77172221 ATGAGAAAACAGGTTGGGGAAGG - Intergenic
1141127793 16:81413485-81413507 ATGAGGAAACAAGGTTAGGGAGG - Intergenic
1141220765 16:82067621-82067643 ATAGGGAAAAAGGCCCAGGAGGG + Intronic
1141269501 16:82526081-82526103 ATGAGGTAAATGGCTAAGGAAGG + Intergenic
1141413720 16:83854107-83854129 AGTAGAACACAGGCTCAGGACGG + Intergenic
1141560337 16:84863598-84863620 ATGAGGAAGAAGGCTCAGAGAGG - Intronic
1141712557 16:85708383-85708405 GTGAGGACACAGGCTCAGAGAGG + Intronic
1141760171 16:86023031-86023053 ATGAGGAAACAGGCTCAGATAGG + Intergenic
1141768625 16:86075039-86075061 ATGGAGAAACAGGCCCAGGGTGG - Intergenic
1141929832 16:87194971-87194993 ATGAGAAAACAGACTCAGAGAGG + Intronic
1141984775 16:87572646-87572668 ATAAGGAAACAAGCTCAGAGAGG + Intergenic
1141990526 16:87606597-87606619 ATGAAGAAACAAGCTCAGAGAGG - Intronic
1142114803 16:88351076-88351098 ACCAGGAAACAGGCCCAGCAAGG - Intergenic
1202992288 16_KI270728v1_random:22941-22963 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1203056548 16_KI270728v1_random:930729-930751 ATGAAAAAACAGTTTCAGGAAGG + Intergenic
1203089168 16_KI270728v1_random:1201976-1201998 AGGAGGAAACAGGCTCAGAGAGG + Intergenic
1203115172 16_KI270728v1_random:1482736-1482758 ATAAGCAAACAGGCTCAGACTGG - Intergenic
1142590674 17:1004355-1004377 AGGAGTAAACAGGCTCAAAAAGG + Exonic
1142858618 17:2747976-2747998 ATGAGGAGACAGGCTTAGAAAGG + Intergenic
1143020989 17:3917133-3917155 ATGAGGAAGCAGGCTCGGAGAGG - Intergenic
1143057242 17:4171517-4171539 ATGAGGAAGCAGGCCTATGAGGG + Intronic
1143208983 17:5169220-5169242 ATGAGGAAATAGATTCAGGGAGG - Intronic
1143270173 17:5669472-5669494 AAGTGGAGACAGGCTCAGGGAGG + Intergenic
1143322951 17:6079922-6079944 ATGAGGAAACTGGCAAAAGAAGG - Intronic
1143392379 17:6567314-6567336 ATAAGGAAACAGGCTTAGAAAGG + Intergenic
1143554800 17:7653345-7653367 AGGAGGAAACAGGGTCAGCAGGG - Intronic
1143618892 17:8069881-8069903 ATGAGGAAACAGGCACAGAGAGG - Intergenic
1143747575 17:9004978-9005000 ATGAGGAAACAGACACAGAGGGG - Intergenic
1143785619 17:9253532-9253554 ATGAGGAGGCAGGCACAGGCTGG + Intronic
1144025505 17:11273146-11273168 ATGAGGAAACAGGTTCAATGGGG + Intronic
1144064576 17:11613097-11613119 ATGAGGATTCAGGGTCAGGGAGG - Intronic
1144613483 17:16746641-16746663 ATGAGGATAAAGACTCAGGTCGG + Intronic
1144620653 17:16816385-16816407 GTGAGGAAACAGGTTCAGAGAGG - Intergenic
1144753018 17:17663103-17663125 AGGGGGAAACAGGCTGAGAAAGG + Intergenic
1144755783 17:17679999-17680021 ATGAGGAAACAGGCGCAGAGTGG - Intergenic
1144822078 17:18082292-18082314 ATGTAGAAACAGGCTCAGAGAGG + Intergenic
1144845809 17:18218401-18218423 ATGAGAAAACAGGCCCAGAGAGG + Intergenic
1144884987 17:18451762-18451784 GTGAGGAAACAGGTTCAGAGAGG + Intergenic
1144966324 17:19078936-19078958 TTGAGGAAACAGACTCAGGGAGG + Intergenic
1144981594 17:19173121-19173143 TTGAGGAAACAGACTCAGGGAGG - Intergenic
1144986630 17:19205118-19205140 TTGAGGAAACAGACTCAGGGAGG + Intergenic
1145133154 17:20376717-20376739 ATGAGGATAAAGACTCAGGTCGG + Intergenic
1145147232 17:20492615-20492637 GTGAGGAAACAGGTTCAGAGAGG - Intergenic
1145215944 17:21052458-21052480 ATCAGGAAGGGGGCTCAGGAGGG + Intergenic
1145225640 17:21125939-21125961 ATGAATAAACTGGCTCTGGAAGG + Intronic
1145301727 17:21645662-21645684 AGGAGGAAACAGACACAGGCAGG + Intergenic
1145302766 17:21652787-21652809 GTGAGGATACAGGCTGTGGATGG - Intergenic
1145347536 17:22050402-22050424 GTGAGGATACAGGCTGTGGATGG + Intergenic
1145348583 17:22057662-22057684 AGGAGGAAACAGACACAGGCAGG - Intergenic
1145416044 17:22714927-22714949 GTGAGGAAACAGGCTGTGGATGG - Intergenic
1145889053 17:28402202-28402224 ATGAGGAACCAGACACAGGTGGG + Exonic
1146287168 17:31581796-31581818 ATGAGGCAACAGGCTCAGCAGGG - Intergenic
1146287527 17:31584287-31584309 TTGAGGAAACAGGGTCAGAGAGG + Intergenic
1146448643 17:32953939-32953961 AGGAGGAAACAGGCCTAGGAAGG + Intergenic
1146556212 17:33826562-33826584 ATGAGGAAACAGGCCCAGAGAGG + Intronic
1146642113 17:34549346-34549368 AGGAGGTAACACCCTCAGGAGGG + Intergenic
1146937414 17:36820903-36820925 ATGAAGAAACTGGTGCAGGAGGG - Intergenic
1147133502 17:38422201-38422223 ATGAGGAAACAGACACAGAGAGG - Intergenic
1147147278 17:38492445-38492467 AGGAGGAAACAGGCTCAGAGAGG + Intronic
1147228769 17:39002082-39002104 ATGAGGAAATAGGGAAAGGAAGG - Intergenic
1147248761 17:39139804-39139826 ATGAGGGCCCAGGCTCTGGATGG - Exonic
1147406339 17:40215082-40215104 ATGAAGAAACAGACACAGCAAGG - Intergenic
1147563222 17:41521499-41521521 ATCAGGAACCAGGCTCAGAGAGG - Exonic
1147563571 17:41523106-41523128 ATCAGGAAATAGGCTCAGAGAGG - Intergenic
1147572039 17:41577285-41577307 ATGAGGAAACAGGTTCACAGAGG - Intergenic
1147605537 17:41771981-41772003 ATGAGGATGCAGGCTGGGGATGG + Intronic
1147608755 17:41789051-41789073 TTGAGGAAACAGGCAAAGGGCGG - Intergenic
1147976746 17:44252371-44252393 ATGAGGAAACAGGCTCAGAGAGG + Intronic
1148222991 17:45877696-45877718 ATGAGGCAGCATGCTAAGGATGG + Intergenic
1148355267 17:46971659-46971681 ATGAAGAAACAGGCCTTGGAAGG + Intronic
1148787900 17:50154487-50154509 TTGAGGAAACAGGCTTTGGGAGG - Intergenic
1149344767 17:55723600-55723622 ATGAGGAAACAGGCTCAGAGAGG + Intronic
1149398742 17:56271861-56271883 AGAAGGAAACAGCCTCAGGGAGG - Intronic
1150004598 17:61462231-61462253 ATCATGAAACAGGCTCTGAAAGG - Intronic
1150655962 17:67039843-67039865 AGCAAGAAACAGGCTCAGAAAGG + Intergenic
1151040880 17:70859889-70859911 ATGAAGAAACAGTCTCAAGCAGG - Intergenic
1151183611 17:72347683-72347705 CTGAGGAAACAGGCTCGTGGAGG - Intergenic
1151395968 17:73823282-73823304 GTGAGAAAACAGGCTCAGAAAGG + Intergenic
1151407919 17:73901498-73901520 GTGAGGAAACTGGGTCAGAAGGG - Intergenic
1151916456 17:77121713-77121735 ATGAGGAAACGGGCTCAGAATGG + Intronic
1152036213 17:77874712-77874734 AAGAGGAAACAGGCTCAGGATGG - Intergenic
1152057556 17:78042387-78042409 ATGAAGAAACAGGCTCAGAGAGG - Intronic
1152218381 17:79047580-79047602 ATGGCAAAACAGGCTCAGCAGGG + Exonic
1153187493 18:2501419-2501441 ATGAAGAAACAGATTCAGGTAGG - Intergenic
1153247711 18:3089737-3089759 ATGAAGAAATAGGCTTAGGAAGG + Intronic
1153273273 18:3344047-3344069 ATGAAGAAACAGATTCAAGAAGG - Intergenic
1153764680 18:8364291-8364313 ATGAGAAAACAGGCTCGGGGTGG + Intronic
1153923174 18:9809144-9809166 AGGTAAAAACAGGCTCAGGATGG - Intronic
1154052539 18:10974691-10974713 ATGAAGAAACGGGCTCTAGAGGG - Intronic
1154285722 18:13054605-13054627 ATGAAGAAACAGGTTGAGGGAGG - Intronic
1154982689 18:21516695-21516717 ATGAAGAAACATGTTCAGGTTGG + Exonic
1155615953 18:27721634-27721656 ATGAGAAAACAGCCTTAGGTGGG - Intergenic
1155639649 18:27998377-27998399 ATGAGGAAATGGGCTTAGGAAGG + Intronic
1156892807 18:42209347-42209369 ATGAGGAAACAGTTTCAATATGG + Intergenic
1157109659 18:44808684-44808706 AGGGGGAAACAAGCTCTGGAAGG - Intronic
1157476730 18:48028688-48028710 GTCAGGAACCAGGCTCTGGAAGG - Exonic
1157611295 18:48957747-48957769 AGGATGACACAGGCACAGGAAGG + Intergenic
1157655262 18:49380746-49380768 ATGAAGAGACAGGCTCAGAAAGG + Intronic
1157790298 18:50525182-50525204 GTGAGGAAAGAGGCTCAGGGTGG + Intergenic
1157866429 18:51190153-51190175 AAGAGAAAACAGGCTCAGAGAGG + Intronic
1158112835 18:53960749-53960771 ATGAGGAAGCAAGCTGAGGCTGG + Intergenic
1158162087 18:54496537-54496559 ATGAGCCAACAGGCTGAGAATGG - Intergenic
1159598836 18:70409498-70409520 TTGAGGAAACAGGCACAGAGAGG + Intergenic
1159816881 18:73085349-73085371 ATGAGGAAACAGACTTAAAAAGG + Intergenic
1160072571 18:75641398-75641420 TTGAGGAAACAGGATCTGTAGGG + Intergenic
1160451395 18:78968740-78968762 ACTGGGAAGCAGGCTCAGGAGGG - Intergenic
1160578912 18:79872741-79872763 GTGAGGAAACAGGCTCAGAATGG - Intronic
1160947017 19:1648385-1648407 ATGAGGAAACAGGCTGGGAGCGG - Intronic
1160986519 19:1841520-1841542 AGGAGGCAACAGGCTCAAGGGGG + Intronic
1161619567 19:5291031-5291053 ATCAGGAAATGGGCTCAGGGAGG + Intronic
1161654160 19:5503414-5503436 ATGAGGAAATAGGCCAAGCATGG - Intergenic
1161887415 19:7007595-7007617 GTGAGGTAACAGGATCAGAAGGG - Intergenic
1161887794 19:7010309-7010331 GTGAGGTAACAGGATCAGAAGGG + Intergenic
1162001074 19:7745421-7745443 ATGAGGAAACTTGCTCAGGCAGG + Intronic
1162453492 19:10768640-10768662 ACCAGGAAACGGGCCCAGGAAGG - Intronic
1162464839 19:10833406-10833428 AAGAGGAAACAGGCTCAGATAGG - Intronic
1162531590 19:11239352-11239374 ATGGAGAAACAGGCTCAGCATGG + Intronic
1162875510 19:13618174-13618196 ATGAGGAAACTGGCCCAGAGAGG - Intronic
1162932529 19:13964083-13964105 AAAAGGAAACAGGCTTAGGGAGG - Intronic
1163091624 19:15023908-15023930 TTGAGGAAACAGGCACAGAGAGG + Intergenic
1163153092 19:15426142-15426164 CGGAGGAAACAGGCTCAGAGAGG - Intronic
1163288795 19:16365214-16365236 ATTAAGAAACAGGCTGAGGGGGG - Intronic
1163374114 19:16919953-16919975 GTAAGGAAACAGGCTCAGAGAGG + Intronic
1163482109 19:17562932-17562954 GTGAGGAAACAGGCTGACGGAGG + Intronic
1163664371 19:18596246-18596268 ATCAGGAAACAGGCTGGGCATGG + Intronic
1164145331 19:22509435-22509457 ATGAGGACACAGACTCAGAAAGG + Intronic
1165060351 19:33202100-33202122 GTGAGGAAACAGGCTCAGAGAGG - Intronic
1165412992 19:35673704-35673726 ATGAGTAAACAGGCCCAGAAAGG + Intronic
1165861787 19:38912811-38912833 GTGAGAAAACAGGCCCAGGAAGG - Intergenic
1166349915 19:42191912-42191934 ATGAGGATATACACTCAGGAAGG - Intronic
1166351738 19:42202050-42202072 ATGGGGAAACAGGCTCAGAGAGG - Intronic
1166429437 19:42711840-42711862 GTGAGGAAAGAGGCTGAGGGAGG + Intronic
1166443069 19:42833167-42833189 ATGAGGAAAGAGGCTGAGGGAGG + Intronic
1166462758 19:43003926-43003948 GTGAGGAAAGAGGCTGAGGGAGG + Intronic
1166468899 19:43060384-43060406 ATGAGGAAAGAGGCTGAGGGAGG + Intronic
1166480045 19:43163905-43163927 AAGAGGAAAGAGGCTGAGGGAGG + Intronic
1166489863 19:43249436-43249458 ATGAGGAAAGAGGCTGAAGGAGG + Intronic
1166598408 19:44072055-44072077 ACGAGCAAGTAGGCTCAGGACGG + Intergenic
1166728653 19:45044913-45044935 AAGAGGAAATGGGCTCAGGGAGG - Intronic
1166739160 19:45103800-45103822 AGGAGGAAACAGGCTCACAGAGG + Intronic
1166840606 19:45694785-45694807 ATGAGGAAATGGGCTCAGAGAGG - Intronic
1166867676 19:45850527-45850549 AAAGGGAAACAGGCTCAGAATGG - Intronic
1167247296 19:48381330-48381352 ATGAGGAAACAGGTTCAGAGGGG - Intergenic
1167262190 19:48464991-48465013 CTGAGGAATCAGGCTCATAAAGG - Exonic
1167308685 19:48723608-48723630 ATGAGGAAACAGAATCAGGTAGG - Intronic
1167733641 19:51277932-51277954 CTGAGTAAACAGGCGGAGGAAGG + Intergenic
1167772717 19:51530971-51530993 ATGGGGACGCAGGATCAGGATGG + Intronic
1168233359 19:55047030-55047052 ATGAAGAAACAGGCTCAGAGGGG + Intronic
1168292643 19:55364053-55364075 ATGGAGAAACAGGTTCAGTAAGG - Intergenic
1168724164 19:58571539-58571561 ATGAGGAAACAGGCAAAGAAAGG + Intronic
925810381 2:7694362-7694384 ATGAGAAAACAGGCCCAGGAAGG + Intergenic
926088505 2:10035159-10035181 ATGAGAAAACAGGCTCAGAGAGG + Intergenic
926110662 2:10181224-10181246 ATGAGGAAACAGGCTTAGAGTGG + Intronic
926210727 2:10867703-10867725 AAGAGGAAACAGGCTCAGAGAGG - Intergenic
926365665 2:12130803-12130825 ATAAGGACACAGGTTCAGGCTGG - Intergenic
926390609 2:12387521-12387543 ATGATAAAACAGCCTCAGGCAGG - Intergenic
926412954 2:12624026-12624048 TAGAGGAAAAAGGCTCAGAAAGG - Intergenic
926513062 2:13806704-13806726 CTGAGACAAAAGGCTCAGGATGG + Intergenic
926986265 2:18627624-18627646 ATGAGGAAGCAGGCTCAAAAGGG - Intergenic
927412519 2:22843539-22843561 AAGAGGACACAGGCCCAGGGAGG + Intergenic
927415792 2:22879185-22879207 ATGAGATAACAGGCCCAGGAAGG - Intergenic
928098059 2:28417576-28417598 AGAAGGAAACAGGATCAGGAGGG - Intergenic
928254330 2:29708791-29708813 ATGAGGAAACAGGCCTAGAGAGG - Intronic
928564036 2:32524478-32524500 ATGAAGAAACAGCCTTAGAAAGG - Intronic
928697706 2:33866749-33866771 ATGAGGAAACAGGCATACAAAGG + Intergenic
929033203 2:37667902-37667924 ATGAGAACACAGGCTCAGAAAGG - Intronic
929048313 2:37812576-37812598 ATGAGAAAACAGACGCAAGAGGG + Intergenic
929753447 2:44741489-44741511 ATCAGAAAACAAGCTCAGAAAGG + Intronic
929769803 2:44882080-44882102 ATAAGGAAACAGACTCAGAGAGG - Intergenic
929870166 2:45752549-45752571 ATGAGGAAACAGGCTCAGAGAGG - Intronic
929902858 2:46020964-46020986 CTAAGGAAACAGACTCAGGGAGG + Intronic
929922590 2:46183009-46183031 ATGAGGAAACTGGCTCAGAGAGG - Intronic
930025001 2:47024460-47024482 ATAAGGAAACAAACTCAGGGAGG - Intronic
930675001 2:54191068-54191090 ATGATGACTCAGGCTGAGGAGGG - Intronic
930678615 2:54231575-54231597 ATGAGGAAACAAACTCAGAGAGG - Intronic
930750213 2:54927295-54927317 AGCAGGAAACAGGTGCAGGAGGG - Intronic
930755826 2:54970996-54971018 AAGGGGAAAAAGGCTCAGGAAGG + Exonic
931173227 2:59827110-59827132 ATGAGGAAACAGGTTCAGAAAGG + Intergenic
931263708 2:60641872-60641894 GTGAGGAAACAGGCCCAGTGAGG - Intergenic
931601345 2:64006467-64006489 ATTAGGAAACAGACTTAGGAAGG - Intronic
931632747 2:64316028-64316050 CTGAGAAAACAGCATCAGGATGG - Intergenic
932428967 2:71662074-71662096 ATGGGGAAACAGGCATGGGAGGG - Intronic
932600021 2:73117268-73117290 AGGTGGAAACAGACTCAGTAGGG - Intronic
932605637 2:73163617-73163639 ATGAGGAAACAGACACAGAGAGG + Intergenic
932626050 2:73296652-73296674 ATGAGGAAACAGATTCAAAAAGG + Intergenic
932823830 2:74922790-74922812 ATGAGGAAACAGGCTCAAAAAGG + Intergenic
933588975 2:84210668-84210690 ATGAAGAAACAGGCACAGAGAGG - Intergenic
933651601 2:84854477-84854499 ATAAGAAAACAGACTCAGAAAGG + Intronic
935171242 2:100612765-100612787 TTGAGGACAGAGGCTCAGAAAGG + Intergenic
935294948 2:101640710-101640732 TTGAGGAAACAGGCCAGGGAAGG + Intergenic
935803450 2:106723260-106723282 AGGAAGAGAGAGGCTCAGGAAGG + Intergenic
936449428 2:112622636-112622658 ATGAGTAAGCAAGCTCAGGGAGG - Intergenic
936524645 2:113234435-113234457 ATGAGGAACCTGGCCCAGGGAGG - Intronic
936596946 2:113857133-113857155 ATGAGGATACAGGGTGAAGATGG + Intergenic
936603348 2:113922390-113922412 ATGAGAAAAAAGGCTAAGTATGG + Intronic
936920505 2:117684056-117684078 ATAAAGGAACAGGATCAGGATGG - Intergenic
937549181 2:123065662-123065684 ATGAGGAAACAGACCAAGAAAGG - Intergenic
937867432 2:126763609-126763631 ATGAGGCAGCAGGCTCAGTGAGG + Intergenic
937962118 2:127468097-127468119 TTGAAGAAGCAGGCTCAGAAAGG - Intronic
938758405 2:134401397-134401419 ATGATGTAGCAGACTCAGGAAGG - Intronic
939396889 2:141642268-141642290 ATGAGGAAACAGATTCAGAGAGG - Intronic
939519368 2:143210289-143210311 TTTGGGAAACAGGCTGAGGAAGG - Intronic
939712155 2:145535840-145535862 AGCAAGAAACAGGCTCTGGAGGG - Intergenic
939880951 2:147630718-147630740 ATGAGGAAACAAGGGCAGAAAGG - Intergenic
939892474 2:147753855-147753877 ATGAGGAAACAGCCACTGGTTGG - Intergenic
940491653 2:154369618-154369640 AAGAGGAGACTGGCTCATGAGGG - Intronic
941284293 2:163589991-163590013 ATGAGGAAACAAGCGCAGAAAGG + Intergenic
941317086 2:164007140-164007162 AAGAGGAAACAAGCTCAAAAAGG - Intergenic
941530845 2:166668889-166668911 ATGAGGAAACAGGTTCAGAAAGG + Intergenic
941848837 2:170158931-170158953 ATGAGAAAACTGGCTTAGGAAGG - Intergenic
943723034 2:191225063-191225085 ATGAGGAAATGGGTTCAGAAAGG - Intergenic
944641172 2:201727619-201727641 ATGTGAAAAAAAGCTCAGGAAGG - Intronic
944669706 2:201984737-201984759 ATTAGGAAACAGGCCCAGCAAGG + Intergenic
945464473 2:210151645-210151667 AAGAAGAAACAGACTCAGCATGG - Intronic
945801296 2:214434601-214434623 ATGAGGAAATGGGCTGAGAAAGG - Intronic
945942962 2:215968127-215968149 ATGAGAAAACAGGCCCAGAGAGG + Intronic
946153665 2:217793056-217793078 ATGTGGAAACAAGCACAGCAGGG + Intergenic
946389435 2:219406583-219406605 GTGAGGAAACAGGCTCAGAGAGG + Intergenic
947277806 2:228413815-228413837 ATGAGAACACAGGCTCAGGGTGG - Intergenic
947464379 2:230327902-230327924 AAGAAGAAAAAGGCCCAGGATGG + Intronic
947526123 2:230877773-230877795 ATGAGGAAACAGGTGCAGAGAGG + Intronic
947835739 2:233173971-233173993 AGGCTGAAACAGGCTCAGGATGG + Intronic
948151341 2:235747350-235747372 ATGTGGAAAGATGCCCAGGAAGG + Intronic
948262537 2:236614830-236614852 ATGAGAAAACAGGCTCACAGAGG - Intergenic
948341523 2:237256525-237256547 CTGAGGAATGAGGCACAGGAGGG + Intergenic
948970840 2:241425254-241425276 TTCAGGACACAGGCACAGGAAGG + Intronic
1168758039 20:329376-329398 AGGAGGAAACGGGGTCAGGCAGG + Exonic
1168803096 20:656076-656098 ATTAGGAAACAGGCACAGACAGG - Intronic
1168811403 20:706874-706896 ATGAGGAAACAGGCCCAGAGAGG - Intergenic
1168860945 20:1045743-1045765 TTGAGGAAACAGCCTCAGAGAGG + Intergenic
1168862206 20:1053687-1053709 AGGAGGAAACAGGCTGAGGAGGG - Intergenic
1168960937 20:1869210-1869232 ATAAGGAAACAGGCTCAGAGAGG - Intergenic
1169165601 20:3420939-3420961 ATAAGGAAACAGCCTCAGAAAGG + Intergenic
1169165717 20:3421879-3421901 GGGAGGAAAAAGGTTCAGGAAGG - Intergenic
1169294485 20:4381980-4382002 ATGGGAAAACAGGCTGAGAATGG - Intergenic
1169296354 20:4403295-4403317 ATGAGAAAACAGGCTTGGGGAGG - Intergenic
1170341932 20:15338668-15338690 ATGAAGAAACAGGCCTAGGGGGG + Intronic
1170543261 20:17410196-17410218 ATAAGGAAACAGGCTCAGAAGGG + Intronic
1170771529 20:19337009-19337031 ATGAAGAAACAGACTCAGAGAGG - Intronic
1170910292 20:20559711-20559733 ATGAGGAAATAGGAGGAGGAGGG + Intronic
1171040631 20:21759186-21759208 AGAAGGAAACAGGCTCAGCATGG - Intergenic
1171181781 20:23096283-23096305 AGGAGGGACCTGGCTCAGGAGGG + Intergenic
1171236011 20:23525701-23525723 AGGAGGAAACAGTCACAGAAAGG + Intergenic
1171494583 20:25546957-25546979 ATGAGGACACAGGCACATGCAGG - Intronic
1171518304 20:25757045-25757067 AGGAGGAAACAGACACAGGTAGG + Intergenic
1171519354 20:25764318-25764340 GTGAGGAAACAGGCTGCGGATGG - Intronic
1171557569 20:26092173-26092195 GTGAGGAAACAGGCTGCGGATGG + Intergenic
1171558553 20:26099161-26099183 AGGAGGAAACAGACACAGGCAGG - Intergenic
1171989880 20:31687818-31687840 ATAAGGAATCAGGCTCAGAGAGG - Intronic
1172024062 20:31935983-31936005 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1172063772 20:32205645-32205667 ATGAGGAAACAGGCTAATAATGG - Intronic
1172134967 20:32680727-32680749 ATTAGGAAACAGGCCCAGAGAGG - Intergenic
1172204375 20:33152376-33152398 ATGAGAAAAAAGGCTCAGAGAGG + Intergenic
1172273824 20:33669204-33669226 ATGAGGAAACAGGCCCAGAGAGG + Intronic
1172293891 20:33794483-33794505 ATGAGGCAACAGGCACATTAAGG + Intergenic
1172374828 20:34430191-34430213 ATGAGAAAACAAGCTTAGAAAGG + Intronic
1172509481 20:35490501-35490523 ATGAGGCAACAGGCTTAGAGAGG + Intronic
1172548786 20:35782783-35782805 GTGAGGAAACAGGCTCATATAGG - Intronic
1172610701 20:36249725-36249747 ATGAGGAAGCAGGCTCAGGAAGG + Intronic
1172840423 20:37899869-37899891 ATGAGGACATAGGTTCAGAAAGG - Intergenic
1172848945 20:37946885-37946907 TTGAGGAAACAGGCTCAGAGAGG + Intergenic
1172860957 20:38051516-38051538 ATGAGGATACTGGCTCAAAAAGG + Intronic
1173119977 20:40279880-40279902 ATGAGAAAACAGACTCAGAGAGG - Intergenic
1173163477 20:40669878-40669900 CTGTGGACACAGGCCCAGGAGGG + Intergenic
1173364572 20:42373193-42373215 CTGAGGAGACAGGCTCAGAGAGG + Intronic
1173372657 20:42451650-42451672 AGAAGGAAAGAGGCTCAAGAAGG + Intronic
1173541559 20:43856007-43856029 ATGAGGACATAGGCTCAGAGAGG - Intergenic
1173542387 20:43863860-43863882 ATGAGGAAACAAGCTCAGAAAGG - Intergenic
1173609650 20:44357257-44357279 ATGAGGAAATAGGTTCAGAGAGG - Intronic
1173613861 20:44390215-44390237 ATGGAGAAACACGCTCAGAAAGG + Intronic
1173671186 20:44800006-44800028 ATGAGGAAACAGGCTCAGGGAGG + Intronic
1173735166 20:45355770-45355792 ATGAGAAAACAGGCGGAGCAAGG + Intergenic
1173846449 20:46191631-46191653 ATGAGGAAACGGGCTCAGAGGGG + Intronic
1173847375 20:46196691-46196713 ATGAGGAACCTGACTCAGCAAGG - Intronic
1173852520 20:46227907-46227929 AAGAGGAAACAGACTCAGAGAGG - Intronic
1173862918 20:46296051-46296073 ATGAGGCAACAGGCCCGGCATGG - Intronic
1173868087 20:46325529-46325551 ATGAAGAAACATGCTCAGAGAGG - Intergenic
1173916995 20:46715044-46715066 AGGAAGCAACAGGATCAGGATGG - Intronic
1173934779 20:46851840-46851862 ATGAGAAAACAGGCTCAGAGAGG + Intergenic
1173943281 20:46930375-46930397 ATGAGGAAACAGGCTCAGAAAGG + Intronic
1174053454 20:47783040-47783062 ATGAGGAAACAGGCACAGAGAGG - Intronic
1174057614 20:47809549-47809571 CTGGGGAAACAGGCTCAGGGAGG + Intergenic
1174146119 20:48453818-48453840 ATGAGGAAACAGGCCTAGACAGG - Intergenic
1174298469 20:49565734-49565756 AGGAGGAAACAGGCTCAGAAAGG - Intronic
1174307280 20:49622649-49622671 ATGAGGAAACATGCTCAGCAAGG - Intergenic
1174362812 20:50039235-50039257 ATGAGGAAACAGGCTTAAAGAGG - Intergenic
1174406091 20:50304374-50304396 CAGATGAAACAGGCTCAGGGAGG - Intergenic
1174459968 20:50675618-50675640 TTGAGGAAACAGGTTCAGGCAGG + Intronic
1174466371 20:50720742-50720764 ATGAAGAAACTGAGTCAGGAAGG + Intergenic
1174519768 20:51120445-51120467 ATGAGGAAACAGGCACAGAGTGG + Intergenic
1175066784 20:56295820-56295842 ATGAGGAAACAAGCTTGGGGAGG - Intergenic
1175129785 20:56780521-56780543 ATGAGGCAACAGTCTCAGAGGGG + Intergenic
1175231154 20:57474184-57474206 GTGAGGAAACAGACTCAGAGAGG + Intergenic
1175477162 20:59284964-59284986 ATGAGGACACTGGCTCAGAAGGG - Intergenic
1175838853 20:62014204-62014226 ATGAGGGGACAGGCACAGGAAGG + Intronic
1175915773 20:62425057-62425079 GTGAGGAAACAGGCTCAGAGAGG - Intronic
1175987404 20:62770848-62770870 ATGGGGAAACAGGCTGGGAAAGG + Intergenic
1176653496 21:9570599-9570621 GTGAGGAAACAGGCTGCGGATGG - Intergenic
1178148181 21:29763699-29763721 ATAAGGAAACTGGAACAGGAGGG + Intronic
1178884427 21:36474113-36474135 ATGAGGCAACAGTTTTAGGATGG + Intronic
1178926060 21:36776005-36776027 AAGAGGACACAGTCTCAGAAAGG + Intronic
1178928981 21:36800556-36800578 GTGAGGAAACAGAGGCAGGAAGG + Intronic
1179294086 21:40045045-40045067 AAGAGGACACAGACACAGGAGGG + Intronic
1179538706 21:42069584-42069606 GTGAGAAAACAGGTTCAGAAAGG - Intronic
1180007062 21:45027688-45027710 ATGAGGAGAGGGGCTCAGGCAGG + Intergenic
1180635560 22:17260501-17260523 ATGAGAAGACAGGCTCAGGGAGG - Intergenic
1181560351 22:23696420-23696442 AAGAGGAAACAGTCTCAGGGAGG + Intronic
1181562170 22:23711842-23711864 TTAAGGAAACAGGCTGAGCATGG + Intergenic
1181584599 22:23846188-23846210 ATGAGAAAATAGGCTCAGAGAGG + Intergenic
1181584665 22:23846568-23846590 GTCAGGACACAGGCTCAGGCAGG - Intergenic
1181693901 22:24583369-24583391 ATGAGGGAACAGGCTCTGAGAGG + Intronic
1181783701 22:25210469-25210491 ATGAAGAAACAGGCTCAGGGAGG + Intergenic
1181803754 22:25362869-25362891 ATGAGGAGACAGGCCCAGAGAGG - Intronic
1181900641 22:26152732-26152754 ATGAGGAAACAGGTACAGAGAGG - Intergenic
1181937282 22:26447997-26448019 ATGAGGAAACAGGCTCAGAGCGG + Intronic
1182078496 22:27511733-27511755 ATGGAGAAACAGGTTCAGGGAGG - Intergenic
1182111857 22:27729396-27729418 ATGGGGAAACAGACTCAGAAAGG - Intergenic
1182297126 22:29316197-29316219 AAGAGGAAACAGGCCCGAGAGGG + Intronic
1182300149 22:29332647-29332669 ATGAGGACACCGTCTCAGGGAGG + Intronic
1182438145 22:30344499-30344521 AAGCAGAAACAGGCTCAGAAAGG - Intronic
1182448264 22:30402491-30402513 ATGAGAAAACAGGCTCAGAGAGG + Intronic
1182553062 22:31111929-31111951 GTTAGGAAACAGGCTCAGAAAGG + Intronic
1182554271 22:31120520-31120542 ATGCTGAAACAGGCTGAGGGTGG - Intergenic
1183032476 22:35116426-35116448 GTGTGGAAACAGGCTCAGAGAGG + Intergenic
1183040604 22:35175007-35175029 ATGTGGAATCTGGCTCAGGGTGG - Intergenic
1183072161 22:35403638-35403660 AGGAGGAGACAGGTTCAGAAAGG - Intronic
1183083546 22:35472738-35472760 ATAAGGAAACAGGTTCAGAGAGG - Intergenic
1183195681 22:36352006-36352028 ACTAGGAAACAGACTCAGAAAGG + Intronic
1183228345 22:36565235-36565257 ATGAGGAAACAAGCACAGAGAGG + Intronic
1183236738 22:36624408-36624430 ATGAGAAAACAGGCCCAGAGAGG + Intronic
1183313480 22:37124386-37124408 ATTAGGAAACAGGCCCAGGGAGG - Intergenic
1183321628 22:37168521-37168543 ATGCAGAAACAGGCTCAGAGAGG - Intronic
1183370567 22:37429406-37429428 AGGAGGAAACAGGCTCAGAGAGG - Intergenic
1183445990 22:37855473-37855495 ATGAGGACCCAGGCTTAGAAAGG - Intronic
1183456713 22:37926920-37926942 ATGAGGCAACAGGCTTAGAGAGG - Intronic
1183487558 22:38097640-38097662 ATGGGGCCCCAGGCTCAGGAAGG + Intronic
1183575390 22:38685155-38685177 AAGAGGAAACAGCCACAGAAAGG + Exonic
1183650200 22:39149257-39149279 GTGAGGAAACAGGCTCAGAGAGG - Intronic
1184064602 22:42110518-42110540 TTGAAGAAACAGAGTCAGGAAGG - Intergenic
1184088390 22:42279693-42279715 ATGAGCAAACAGGCTCAGGGAGG + Intronic
1184410612 22:44323982-44324004 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
1184444117 22:44537259-44537281 ATGAGGAAACAGGCTCAGAGGGG + Intergenic
1184473489 22:44708654-44708676 ATGAGCAAACAGGCTCGGAATGG + Intronic
1184480513 22:44744176-44744198 ATGAGGATGCAGGATCAGGCGGG + Intronic
1184517546 22:44971929-44971951 ATAAGAAAACAGGCTCAGGGAGG + Intronic
1184581587 22:45421653-45421675 GTAAGGACACAGGCTCAGCAAGG + Intronic
1184841324 22:47053969-47053991 AGGAGGAAACAGGCTGAGAGAGG + Intronic
949535595 3:4993770-4993792 ATAAGGAAACAGATTCAGGAAGG - Intergenic
949680324 3:6506114-6506136 ATAAGGAAACAGGATCACAAAGG - Intergenic
950131162 3:10547602-10547624 ATGAGAAAACAGGCCCAGAGAGG + Intronic
950180785 3:10911756-10911778 ATAAGGAAACAGCCTCAGAGAGG + Intronic
950185650 3:10943829-10943851 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
950192302 3:10985932-10985954 GTGAGGAAACAGGCACAGAGAGG - Intergenic
950276648 3:11666942-11666964 ATGAGGAAGCGGAGTCAGGAAGG - Intronic
950290934 3:11783864-11783886 ATCAGGAAACAGGCTCAAAGAGG - Intergenic
950452926 3:13075456-13075478 AGGCGGAAACAGGCTCAGAGTGG + Intergenic
950458591 3:13107481-13107503 ATGGAGAAACAGGCTCAGAGCGG + Intergenic
950660771 3:14465595-14465617 ATGAGGAAACAGGTCCAGAGAGG + Intronic
950665042 3:14490214-14490236 ATGAGGAAACAGGCACAGAGAGG - Exonic
951051159 3:18095710-18095732 ATGAAGAAACAGGCACAGAAAGG - Intronic
951738019 3:25889170-25889192 AAGAGGAAACACCCTCTGGAGGG + Intergenic
951845961 3:27084840-27084862 ATGAGAAAACAGGCTCAGAGAGG - Intergenic
952071326 3:29640021-29640043 ATCAGGAAGCATGCTCTGGAAGG + Intronic
952140494 3:30473567-30473589 ATGAGGAAACAGGCTAAGGGAGG - Intergenic
952169501 3:30791422-30791444 AAGTGGAGGCAGGCTCAGGAAGG - Intronic
952176311 3:30867058-30867080 ATGAGAAAACAGGCACAGAGAGG - Intronic
952395646 3:32918287-32918309 ATGAGGAACCACGACCAGGAAGG - Intergenic
952421930 3:33140188-33140210 ATAAGGAAACAAACTCAGAAAGG + Intronic
952515728 3:34103361-34103383 ATGAGGAAACAGCCTCAGAAAGG - Intergenic
952521619 3:34164920-34164942 ATGAGAAAACAGGCTCAGAGAGG + Intergenic
952531038 3:34262281-34262303 GAGAGGAAACAGACTCAAGAAGG - Intergenic
952840352 3:37640795-37640817 GTGAGGAAACAGGCTCTAAAGGG - Intronic
952962047 3:38598452-38598474 AGGAGGGAACAAGATCAGGATGG + Intronic
953587167 3:44213171-44213193 AGCAGGAAACAGTCTCAAGAAGG + Intergenic
953598765 3:44343206-44343228 ATGAGGAAACAGACTCCAGAAGG + Intronic
953706125 3:45231875-45231897 ATGAGAAAACAGGTGCAGGAAGG + Intergenic
953877490 3:46674598-46674620 ATCAGGAAAGAGGCTCAAGTTGG + Exonic
953961948 3:47273312-47273334 ATGAGGAAACAGGCTCAGTGTGG + Intronic
953971099 3:47347661-47347683 ATAAGGAAACTGCCTCAGAATGG + Intergenic
954552856 3:51496641-51496663 ATGAGGAAACTAGCTCAGAGAGG + Intronic
954792351 3:53142776-53142798 ATGGGGAAACAGGCTCTGCAGGG - Intergenic
954988065 3:54813257-54813279 ATGAGGAAATAGACCCAGCAAGG + Intronic
955008477 3:54991765-54991787 ATGAAGAAACAGGCTCAGAGAGG - Intronic
955209250 3:56925661-56925683 ATGAGGAAAGAGGCTCAGAAGGG + Intronic
955393512 3:58537861-58537883 GTAAGGAAACAGGCTCAGGGAGG + Intergenic
955614022 3:60786508-60786530 ATGAAGTAACAGACTCAGGTAGG - Intronic
955644779 3:61125780-61125802 ATGGGGAAACAGGAAAAGGATGG + Intronic
955822663 3:62912593-62912615 ATGAGCAACCAGGCTCAGAGGGG + Intergenic
956302239 3:67784831-67784853 ATGAGGAAACAGGCTTAGAAAGG + Intergenic
956320047 3:67986358-67986380 ATGAGAAAACAGCCTCAGATAGG - Intergenic
956442630 3:69295164-69295186 GTGATGAAACAGGCCCAAGAGGG + Intronic
956541136 3:70340953-70340975 AAGAGGGAACAGACTCAGAAAGG - Intergenic
956647436 3:71470230-71470252 ATGAAGAAACAGGCTCAGGAAGG - Intronic
956743786 3:72295469-72295491 GTGAGGAAACAGGCTCAGAGAGG - Intergenic
956772219 3:72536301-72536323 ACTAGGAAACAGGCTCAGAGAGG + Intergenic
957167991 3:76699803-76699825 AAGAGGAAACAGGGGGAGGAAGG - Intronic
957386704 3:79505302-79505324 AAGAGGAAGCAGGTTGAGGAAGG + Intronic
957588906 3:82170317-82170339 ATGAGGAAACAGGTTTACGGAGG - Intergenic
957866490 3:86031086-86031108 ATGAATAAACAGACTTAGGAAGG + Intronic
958252569 3:91287556-91287578 ATGAGCAAACAGGCTCTAGGTGG - Intergenic
958880831 3:99667052-99667074 ATGAAGAAACAGATTCAGGAAGG + Intronic
959510191 3:107202110-107202132 ATGATGAAACAGGAGCAGGGAGG + Intergenic
959572386 3:107898960-107898982 ATGAGGAAACAAGCTTAGAGGGG + Intergenic
959751002 3:109834962-109834984 ATGAAGAAACAGGCTTAGAGAGG + Intergenic
959799014 3:110467655-110467677 ATGAGGCAACAGGCACAGAGAGG - Intergenic
959883744 3:111475164-111475186 CTGGGAAAGCAGGCTCAGGATGG - Intronic
960515758 3:118600662-118600684 CTGAGGAAACATGCTCAGAAAGG + Intergenic
960701288 3:120441854-120441876 ATGGGGAAACAGGCTCAGAGAGG + Intronic
961062665 3:123844558-123844580 ATGAGTTAACAGGCTTAGAAAGG - Intronic
961115698 3:124327923-124327945 AAGAGGAAACAAGCTCAGAATGG - Intronic
961119435 3:124361090-124361112 ATGAGGAATCAGGCTTAGAGAGG + Intronic
961141960 3:124563303-124563325 AAGATGAAACTGACTCAGGAAGG - Intronic
961159395 3:124709926-124709948 ATGAGGAAAAGGGGTCATGAAGG + Intronic
961175581 3:124832382-124832404 ATGAGGAAACAAGCCTAGAAAGG - Intronic
961409483 3:126708260-126708282 GTGAGGAAACAGGTTCAGTGAGG + Intronic
961457131 3:127029803-127029825 ATGGGGAAACAGGCTCGGGCGGG + Intronic
961556442 3:127699541-127699563 ATGAGGAGACAAGCTCAGAGAGG + Intronic
961573380 3:127816405-127816427 TTGAGGACAAAGTCTCAGGAAGG + Intronic
961631815 3:128306785-128306807 ATGAGAAAACTGACTTAGGAAGG + Intronic
961634794 3:128326437-128326459 CTGAGGTAACTGGCCCAGGATGG - Intronic
961818611 3:129564007-129564029 AGGAGGAAACAGGCTCATAGGGG + Intronic
961823504 3:129587099-129587121 CTCAGGAAACAGGCTCAGAGAGG - Intronic
961827020 3:129604443-129604465 ATGAAGAAACAGGCACAGAGAGG - Intronic
961916632 3:130382089-130382111 ATGAGGAAATGGGAACAGGAAGG + Intronic
961983873 3:131111648-131111670 ATGAGGAAACAGGTTCAGAGAGG - Intronic
962016532 3:131446442-131446464 ATAAGAAAACAGGCACAGAAAGG - Intergenic
962479203 3:135783956-135783978 ATGAGGAAACAGGCACAGGGAGG - Intergenic
962606247 3:137035162-137035184 CTGAGGGCTCAGGCTCAGGAAGG - Intergenic
962932875 3:140053755-140053777 ATAATGAAACAGGCTTATGAAGG - Intronic
962970490 3:140396579-140396601 ATGAGGAAACAGGCACAGAGAGG + Intronic
963041236 3:141071547-141071569 ATGAGGAAACTGTCTTGGGAAGG + Intronic
963918206 3:150880153-150880175 GTGAGGAAACAGGCTCAGAGAGG + Intronic
964447364 3:156773978-156774000 ATGAGGAAACAGGTCTAGAAAGG + Intergenic
964478913 3:157122744-157122766 ATGAGAAAACAGGCTCAGAAGGG + Intergenic
964497899 3:157313741-157313763 TTCAGGAAACAGGCTCTGAAAGG + Exonic
964514009 3:157486611-157486633 ATGAGGAAACAGACATAGAAAGG - Intronic
964623713 3:158739314-158739336 CTCAGGAAAGAGGCTCAGGATGG + Intronic
964837341 3:160954111-160954133 ATGAAGAAACAGACTCAGAGAGG - Intronic
965648091 3:170905800-170905822 ATGAGAAAACAGGCTCAGAAAGG + Intronic
965983547 3:174723213-174723235 ATTAGGAAATAGGCTCAGAAAGG - Intronic
966138667 3:176730174-176730196 ATGAGGAAATAGGTTCAGGAAGG + Intergenic
966586265 3:181629025-181629047 ATGAAGAAACAGGCTCAGAGAGG - Intergenic
966795824 3:183712652-183712674 ATAAGGAAACAGGTCCAGGGTGG - Intronic
966857549 3:184205586-184205608 ATGAGCAAAAAAGTTCAGGAAGG - Intronic
966909675 3:184551990-184552012 GTGAGGAGACAGGCTTAGGGAGG + Intronic
966945989 3:184777424-184777446 ATGAGGAAACAGGCCCAGGGAGG + Intergenic
966952525 3:184835237-184835259 ATGAGAAGATAGGCTCAGGAAGG + Intronic
967080564 3:186045789-186045811 ATAACGAAAAAAGCTCAGGAAGG - Intergenic
967189322 3:186972130-186972152 ATGAGGAAACAGGCATAGAGAGG + Intronic
967230701 3:187335071-187335093 ATGAGCAAACAGGCCCAGAGAGG + Intergenic
967980773 3:195063896-195063918 ATGAAGAAACAGGCCCAGAGAGG + Intergenic
968247931 3:197173421-197173443 ATGAGGAGACAGACTCCGCATGG + Intronic
968729065 4:2261341-2261363 CTGGGGAAACAGGCTCAGCCAGG - Intronic
969257515 4:6012357-6012379 ATGAGGAAATAGGATCAGAGGGG + Intergenic
969377107 4:6770131-6770153 ATGAGGTAACAGGCTCAGAGGGG + Intergenic
969438241 4:7200740-7200762 ATGAGGAAAAAGGCTCAGAGAGG - Intronic
969452785 4:7284368-7284390 GCAAGGAAACAGGCTCAGGGAGG - Intronic
969552172 4:7877548-7877570 GTGAGGAAACAGACACAGAAAGG + Intronic
969639255 4:8387270-8387292 ATGAGGAAACCGAGGCAGGAAGG + Intronic
969688041 4:8687921-8687943 CTGAGGAAACAGGATCAGAGAGG + Intergenic
969906800 4:10404732-10404754 ATGAGGAAACAGGCACAGAGAGG + Intergenic
969966699 4:11003864-11003886 ATGGAGAAACAGGCTCAGGGAGG + Intergenic
970074097 4:12197598-12197620 ATGAGGAAGGAGGCACAGGAAGG + Intergenic
970138730 4:12956447-12956469 ATGAAGAAACAGGCTCAGCAAGG - Intergenic
970158408 4:13164716-13164738 GTGAGAAAACAGACTCAGGGAGG - Intergenic
970369583 4:15393680-15393702 TTGAGGAAACAGGCTTAGAGAGG - Intronic
970434358 4:16019070-16019092 ATGAGGAAATTGGCTCAGAGTGG - Intronic
970437334 4:16048272-16048294 ATAAGGAAATAGGCTCAGTCAGG - Intronic
970672760 4:18415320-18415342 ATGAGGAAACAGATTCAGTGAGG - Intergenic
971073308 4:23119757-23119779 GTGAGGAAACAGACTCAGAGGGG + Intergenic
971161280 4:24136659-24136681 GTGAGGAAACAGGCTGGGAAAGG - Intergenic
971263783 4:25080292-25080314 ATTAGGAGACAGGCTCAGAGAGG + Intergenic
971761883 4:30776607-30776629 CTGAAGAAACGGTCTCAGGAAGG - Intronic
971801821 4:31303066-31303088 ATGAGAAAACAGGCTGGGCACGG + Intergenic
971897753 4:32619071-32619093 CTGAGTTAACAGGCTCAGAAGGG + Intergenic
972428408 4:38956794-38956816 ATGGGGAAGCAGGCGCAGTAGGG - Intergenic
972594162 4:40515699-40515721 ATGAGGAGACGGGCTCAGGGAGG - Intronic
972631240 4:40843805-40843827 ATGAGGAAACAAGTTCAGAGAGG + Intronic
973646188 4:52953475-52953497 ATAAAGAAACAAGCTCAGGGAGG + Intronic
973788744 4:54359131-54359153 ATGAGGACATGGGCTCAGCAAGG - Intergenic
973876299 4:55223093-55223115 ATGAGGAAACAGGTTCAGAGAGG - Intergenic
973977631 4:56279108-56279130 ATGGGGAAACAGGCTCAAAGAGG + Intronic
974205543 4:58698101-58698123 ATGAGGAATAAGGAGCAGGACGG + Intergenic
974881315 4:67761048-67761070 ATGTGGGATCAGGCTAAGGAAGG - Intergenic
975371055 4:73588608-73588630 ATGAGGACACAGGCACAGAGGGG - Intronic
975691815 4:76972910-76972932 ATGAGAAAACAGGCTCAGAAAGG + Intronic
976799225 4:88969776-88969798 AGGAGGAAACAAACTCAGAAAGG + Intronic
977148300 4:93475030-93475052 AAGAGGAAGTAGGCTCAGGGAGG - Intronic
977191996 4:94012540-94012562 ATGAGGACACAGGCTCAGCATGG + Intergenic
977229778 4:94438070-94438092 ATAAGAAAACAGGCCCAGCAGGG + Intergenic
977311247 4:95390555-95390577 ATAAGGAAATAGGCCCAGGGAGG - Intronic
977359399 4:95983657-95983679 AAGAGGAAACAGTGGCAGGAAGG + Intergenic
977888664 4:102281330-102281352 ATGAGAAAACAGGGGTAGGATGG + Intronic
978323209 4:107521269-107521291 ATAAGGAAACAGTCTCAGGGAGG - Intergenic
978545269 4:109865184-109865206 ATGAGAAAACAGGCTCAGCAAGG + Intronic
979224410 4:118267617-118267639 ATGAGGAAACAGGTTTGGAATGG + Intergenic
979548385 4:121962940-121962962 ATAAGGAAACAGACCCAGCAAGG - Intergenic
979616545 4:122748900-122748922 ATGAGGAAATTGGCTTAGCATGG + Intergenic
981688905 4:147484318-147484340 ATGAAGCAATAGACTCAGGAGGG - Intronic
981932918 4:150209667-150209689 ATTTGGAAACAGACACAGGATGG + Intronic
982259895 4:153485904-153485926 ATGAGGAGACAGGTTCATCAAGG + Intronic
982759321 4:159262043-159262065 ATGGGGAACCAGACACAGGATGG - Intronic
983637856 4:169916510-169916532 ATGAAGAAAAAGGCTTATGAAGG - Intergenic
983809618 4:172043995-172044017 ATTAGGAAACAGTGTAAGGAAGG + Intronic
984103548 4:175516267-175516289 TTGAAGAAACAGGCTTAGGTTGG - Intergenic
984730611 4:183064918-183064940 CCGAGTAAACAGGCTTAGGATGG - Intergenic
984833146 4:183994656-183994678 ATGAGGAAACGGGCGCAGAGCGG + Intronic
984891973 4:184502335-184502357 ATGAGGAAATAGGCTCAGAGTGG - Intergenic
984914594 4:184710692-184710714 TTGAGGAAACAGCCTCTGGAAGG - Intronic
985264586 4:188146019-188146041 AAAAGAAAACAGGTTCAGGAAGG - Intronic
986002880 5:3643778-3643800 AGGAGGAAACAGCAGCAGGAGGG + Intergenic
986409743 5:7465308-7465330 ATGAGAAAAAAGACTCAGGAGGG - Intronic
986681829 5:10240541-10240563 ATGAGAAAACAGGCTCAGCAAGG - Intronic
986832438 5:11595192-11595214 ATGGGAAAACAGGATGAGGAAGG + Intronic
986832657 5:11598124-11598146 ATGAGGAAACAGATTCAGAGAGG + Intronic
987051149 5:14147212-14147234 ATGAGGAATCAGCCTTAGGGAGG + Intronic
987172023 5:15269125-15269147 ATGAAGAAACAGGCTAAGCAGGG + Intergenic
987184843 5:15406615-15406637 ATGAGGAAATATAGTCAGGAAGG - Intergenic
988216024 5:28273981-28274003 GTCAGGAAACAGGCTGAGCATGG - Intergenic
988569839 5:32353380-32353402 ATGAGGAAACGAGCCCAGAATGG - Intergenic
988722808 5:33894981-33895003 ATGAGGAAACAGACACTGAAAGG + Intergenic
989213946 5:38884547-38884569 AGGAGGAAACTGGCTCAGAGAGG - Intronic
989372674 5:40725630-40725652 AGGAGGTAACAGTATCAGGAAGG - Intronic
989982789 5:50664024-50664046 AAGAGGAAACAGGCTCAAAGGGG - Intergenic
991569748 5:68041584-68041606 GGGAGCAAAAAGGCTCAGGAGGG - Intergenic
991640406 5:68746113-68746135 ATGATGAATTAGGCTCAGGTTGG - Intergenic
992381856 5:76245322-76245344 ATGGAGAAACAGGCTGTGGAAGG + Intronic
992510241 5:77425633-77425655 ATGAAGAAATAGGCTCAGCAAGG - Intronic
992871417 5:81009123-81009145 ATGAGGAAACAGGCTGAAAGAGG - Intronic
992947758 5:81826100-81826122 ATGAGGACACAGGCTCAGGAGGG + Intergenic
993189349 5:84661525-84661547 ATGTAGAAACAGGCTCAGAAAGG + Intergenic
993887087 5:93427382-93427404 ATGTGAGAACAGCCTCAGGAGGG - Intergenic
995798463 5:115965048-115965070 ATGAGGAAACAGACTCAGAGAGG - Intronic
995906791 5:117134365-117134387 CTGGGGAAAAAGGATCAGGAGGG + Intergenic
996962443 5:129267597-129267619 ATCAGGAAACAAGATAAGGAAGG - Intergenic
997639636 5:135440207-135440229 ATGAGGAAACAGGATCAGAGAGG - Intergenic
997716006 5:136043613-136043635 ATGATGAAATTGGCTGAGGATGG + Intronic
997732199 5:136190004-136190026 ATGAGGAAATAGGCTCAGATAGG + Intergenic
997812827 5:136988749-136988771 GGAAGGAAACAGCCTCAGGAAGG - Intronic
997890038 5:137667968-137667990 ATGAGGAAACAGCCTGAGAGAGG + Intronic
998205860 5:140156403-140156425 ATGAGGAGACAAGCTCGGAAAGG + Intergenic
998229929 5:140354589-140354611 ATGAGGAAACAGGCTCAGAGAGG - Intergenic
998296251 5:140971871-140971893 ATGAGGAAATAAGCTCAGGGAGG + Intronic
998501225 5:142634560-142634582 ATGAGGAACCAGACTCAGAGCGG - Intronic
998532875 5:142901686-142901708 ATGAGGAAGCAGGTTCAGAGAGG - Intronic
998630555 5:143893282-143893304 ATGAGTAAACACAGTCAGGAAGG - Intergenic
998813091 5:145986103-145986125 TTGAGGAAACAGGCCCAGAGAGG + Intronic
998892963 5:146766640-146766662 ATGAGAAAACAGGCTCAGAGAGG + Intronic
998930361 5:147174562-147174584 AAGAAGAAACAGGCTTAGAAAGG + Intergenic
999139963 5:149353900-149353922 ATAAAGAAACAGGCTCAGAAGGG - Exonic
999159233 5:149481568-149481590 TTGAGGACACTGGCTCAGAAAGG - Intergenic
999407412 5:151319042-151319064 CTGAGGAAACAAGCTGAGGAAGG - Intronic
999665024 5:153904039-153904061 ATGGGGAAACAGGCTCAGAGAGG + Intergenic
999730445 5:154473345-154473367 ATGGAGAAACAGACTCAGGGAGG - Intergenic
999754090 5:154651780-154651802 ATGAGGAAACAGGCTCTGTCCGG - Intergenic
999805480 5:155077225-155077247 ATGAGAAAACAGGCTCAGGGAGG + Intergenic
1000040528 5:157481499-157481521 ATGAGGAAACAGACTCAAGAGGG + Intronic
1000297759 5:159926924-159926946 ATAAGGAAATGGGCTCAGGGGGG + Intronic
1000380199 5:160622213-160622235 ATGAGGAAACAGACCCAGGGAGG + Intronic
1000383350 5:160648712-160648734 ATGTGGAAACAGGCTCAGAGAGG + Intronic
1000507177 5:162135785-162135807 AAGAGGAAGCAGGGTGAGGAAGG + Intronic
1000740153 5:164959165-164959187 ATAAGGAAACAGGCTTTGCAAGG - Intergenic
1001176018 5:169469669-169469691 ATGAGGAAACAGAGTCAGAGAGG + Intergenic
1001244855 5:170098474-170098496 GTGAGGACACAGGCACAGAATGG + Intergenic
1001279420 5:170375867-170375889 ACGAGGAAACAGGCACAGAAAGG + Exonic
1001399131 5:171436399-171436421 ATCAGGAAACAGACCCAGAAAGG - Intronic
1001399872 5:171440099-171440121 AAGAGGAAACAGGATCAGAAAGG - Intronic
1001431297 5:171664783-171664805 CCGAGGAAACAGGCTCAGAGAGG + Intergenic
1001516302 5:172357540-172357562 ATGAGGAAACAGGGTCTGAGAGG - Intronic
1001553855 5:172623069-172623091 ATTAAGAAACAGGCTCAGAGAGG - Intergenic
1001594231 5:172887494-172887516 AGGAGGAAACAGGCTCCGAGAGG + Intronic
1001913812 5:175542780-175542802 ATGAGAAAACAGGCTCAAAGAGG - Intergenic
1002048473 5:176555411-176555433 ATGAGCAAACAGGCTCTTGCTGG - Intronic
1002052527 5:176579356-176579378 AGGAGACAACAGGCTCAGAAAGG + Intronic
1002053273 5:176584033-176584055 ATGAGGAGACAGGCTCTGAGAGG - Intronic
1002101741 5:176861321-176861343 GTGAGGAAACAGGTTCAGGATGG + Intronic
1002406880 5:179041161-179041183 GTGAGGAGACAGCCACAGGAAGG - Intergenic
1002533649 5:179864281-179864303 ATCAGGACACAGGCTCAGAGAGG + Intronic
1002570666 5:180137730-180137752 AAGAGGGCACAGGCTCAGGAGGG + Intronic
1002633892 5:180597785-180597807 GTGAGGAAGGAGGCTGAGGAAGG + Intergenic
1003263489 6:4546472-4546494 CTGAGCAAGCAGGCTCAGGATGG - Intergenic
1003959930 6:11199372-11199394 ATGAGAAAACAGGCTTAGAATGG - Intronic
1004444124 6:15682165-15682187 TTGAAGAAACAGGCTCAGAATGG - Intergenic
1004477354 6:15986237-15986259 AGGAGGAAACAGGCCCAGAGAGG - Intergenic
1004627733 6:17393195-17393217 ATGAGGATAAAGGCTCTGGGAGG - Exonic
1006099578 6:31678087-31678109 ATGAGGAAACAGGTGCAGAAAGG - Intronic
1006428651 6:33981942-33981964 ATAAAGAAACAGGCTCAGAGAGG - Intergenic
1006520772 6:34569878-34569900 ATGAGGAAACAGGCCCAGAGAGG + Intergenic
1006565058 6:34949001-34949023 ATGAGGAAACAGACACAGTCAGG - Intronic
1006804246 6:36778121-36778143 ATGAGAAAACAGGCCCAGAGAGG + Intronic
1006811632 6:36824028-36824050 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1006919050 6:37615577-37615599 AGGAGGAAGCTGGCCCAGGAAGG + Intergenic
1007100144 6:39240434-39240456 GTGAGGAAACAGGTTCAGAGGGG + Intergenic
1007110780 6:39312533-39312555 GTGAAGAAACAGGCTCAGAGAGG - Intronic
1007340770 6:41190230-41190252 ATGAGGAAACAAGATCAGAGAGG + Intergenic
1007428679 6:41763778-41763800 ATGAGGAAACAGGTTCAGAGAGG + Intergenic
1007431298 6:41779035-41779057 AGGAAGAAGCAGGCTCAGGGAGG + Intronic
1007694729 6:43724998-43725020 GTGGGGAAACAGGCTCAGAGAGG + Intergenic
1007744745 6:44036648-44036670 ATGAAGAAACAGACTCTAGATGG + Intergenic
1008238432 6:49077659-49077681 TGGAGGACACAGGCCCAGGAAGG + Intergenic
1008725201 6:54409069-54409091 ATGAAGAAACAGGCTCAACATGG + Intergenic
1008900627 6:56611264-56611286 ATAAGGAAACAGGCTCAGAGAGG - Intronic
1009191909 6:60639366-60639388 ATGAGCAAACAGGCTCTAGGTGG + Intergenic
1009937117 6:70246888-70246910 ATGAGGAAACAGGCACGGAGAGG - Intronic
1010000004 6:70939695-70939717 ATGAGAACACAGACACAGGAAGG + Intronic
1010002333 6:70959659-70959681 ATGAGGAAACAGGCCTTGGGAGG - Intergenic
1010294258 6:74177681-74177703 ATGGGGAAACAGACTTAGGGAGG - Intergenic
1010388340 6:75308397-75308419 ATGAGGAAACAGGCTCAGATGGG + Exonic
1011002600 6:82607733-82607755 TTTAGGAAACAGACTCAGGGAGG + Intergenic
1011014130 6:82736063-82736085 ATGTGGAAACAGCCCCATGAGGG + Intergenic
1011603244 6:89079317-89079339 CTGGGGAAACAGGCTTAGAAAGG - Intergenic
1012031616 6:94074955-94074977 ATCAGAAAACAGGCTGAGAAAGG - Intergenic
1012230441 6:96754746-96754768 ATGAGGAAACAGGCACAAATAGG + Intergenic
1012347342 6:98207151-98207173 ATGAGAAAACAGGTTCAGAATGG + Intergenic
1012620402 6:101338069-101338091 TCGAGAAAACAGGCTCAAGAGGG - Intergenic
1012840636 6:104324994-104325016 ATGTAGAAACAGCCTCTGGATGG - Intergenic
1013091546 6:106905052-106905074 ATGAGGGACCAGGGACAGGAGGG - Intergenic
1013098297 6:106966227-106966249 ATGAGGAAAGAGGTACAGGCTGG - Intergenic
1013609399 6:111779939-111779961 AAGAAGAAACAGGCTCAGAGAGG + Intronic
1013722543 6:113048373-113048395 ATGAGGAAACAGCTTACGGAAGG - Intergenic
1014044933 6:116874762-116874784 AGAAGGAAACAGGCACAGAAAGG + Intergenic
1014104117 6:117543846-117543868 ATAAGGAAACAGGCTTGGGGAGG - Intronic
1014244965 6:119058306-119058328 CTGAGGCAAGAGGCTCAGTAGGG - Intronic
1015073199 6:129122825-129122847 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1015107264 6:129551505-129551527 ATGAGGAAACAGACTCAAAGAGG - Intergenic
1015203582 6:130609830-130609852 GTGAGGACATAGGCACAGGAGGG - Intergenic
1015496020 6:133884208-133884230 ATCAGGACACAGGGTCAGGTGGG + Intergenic
1015774375 6:136798780-136798802 ATGAAGAAACAGGTCCAGAAAGG - Intergenic
1015954743 6:138587974-138587996 ATGAGGAAACAGAACCAGAAAGG + Intronic
1016090897 6:139977614-139977636 ATGAGGAAACAGACACAAAAAGG - Intergenic
1016336223 6:143007783-143007805 ATGAGGAAACAGTGTGGGGAGGG + Intergenic
1016422133 6:143896562-143896584 ATAAGGAAACAGGTTCAGCAAGG - Intronic
1016914867 6:149235461-149235483 AAGAGGAACTAGGATCAGGAGGG + Intronic
1017675533 6:156809986-156810008 CTGAGGAATCAGATTCAGGAGGG + Intronic
1017993529 6:159510588-159510610 GTGAGGAAATGGGCTCAGGAAGG - Intergenic
1018258276 6:161943972-161943994 CTGAGGAAGCAGCCTGAGGAAGG + Intronic
1019270312 7:143504-143526 AGGAGGCCACAGGCCCAGGAAGG + Intergenic
1019509159 7:1408645-1408667 ATGAGGAAACAGGCTCAGAGAGG - Intergenic
1019668791 7:2267094-2267116 ATGGAGAAACAGGCTCAGGGAGG - Intronic
1021249878 7:18311542-18311564 ATGAGGAAATAGGCACAGAGAGG + Intronic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1021601372 7:22367302-22367324 ATAAAGAAACAGGCTCAGAGAGG - Intergenic
1021747791 7:23760591-23760613 GTGAGGAAACAGGCTTACAAGGG + Intronic
1021800443 7:24300186-24300208 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
1021925090 7:25526606-25526628 ATGAGGAAACAAACTAAAGATGG + Intergenic
1022047878 7:26637803-26637825 ACGAGGAAAGAGGCCCACGAAGG + Intergenic
1022049418 7:26651246-26651268 GTGAGAAAACAGGCTCAGAGAGG + Intergenic
1022340109 7:29459885-29459907 AAGAGGAAAGAGGAGCAGGACGG + Intronic
1022525791 7:31036347-31036369 ATGAAGAAACAGGCTCAGAAAGG + Intergenic
1022578434 7:31522464-31522486 ATGAGGAAAGTTGCTCATGAAGG + Intronic
1022620538 7:31979515-31979537 TTGAGGAAACAGCCACAGGGAGG + Intronic
1022856961 7:34324280-34324302 ATCTGGAAATAGGCTAAGGAAGG - Intergenic
1023132623 7:37017987-37018009 ATGAGGAAACAGGTTCAGGGGGG - Intronic
1023186096 7:37534695-37534717 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
1023289813 7:38657256-38657278 ATGAGGAAACAAGAGCAGAAAGG - Intergenic
1023429875 7:40079603-40079625 AGGAGGAAGCAGGCTCAGAGAGG + Intronic
1023573281 7:41595120-41595142 TTGAGGAATAAGGCTCAGGAAGG + Intergenic
1023816691 7:43955963-43955985 GTGAGGAAACAGACTCTGGGAGG - Exonic
1023858740 7:44203388-44203410 ATAAGAAAACAAGCTCAGGCCGG - Intronic
1024194504 7:47045825-47045847 GTGAGGAAACAGGCTTGAGAAGG - Intergenic
1024282671 7:47732412-47732434 ATGAGGAAACAATCTCAGTGGGG + Intronic
1024940090 7:54753828-54753850 ATGAGGAAACAGGCATGGGGAGG - Intronic
1025192254 7:56904876-56904898 AGGAGGATAAAGGCTGAGGATGG - Intergenic
1025279835 7:57619258-57619280 GTGAGGAAACAGGCTGCGGATGG - Intergenic
1025304897 7:57846243-57846265 GTGAGGAAACAGGCTGCGGATGG + Intergenic
1025679694 7:63672056-63672078 AGGAGGATAAAGGCTGAGGATGG + Intergenic
1025724482 7:64044507-64044529 TTGAGAAAACAGTCTCAGGGAGG - Intronic
1025834932 7:65085561-65085583 ATGGGGAAACGGGCTCAGAGAGG - Intergenic
1025974946 7:66362313-66362335 ATCAGGAAACAGGCTCAACTAGG + Intronic
1026377310 7:69764885-69764907 CTGTGGAACCAGGCTTAGGATGG + Intronic
1026823718 7:73567840-73567862 CTGAGGAAACAAGCTCAGAGAGG + Intergenic
1026836933 7:73645852-73645874 ATGAGGAAACAGGCTCAGAGAGG - Intergenic
1026990526 7:74582617-74582639 ATGTGGAAACAGGCTCAGAGAGG + Intronic
1027597457 7:80192535-80192557 ATAAGGAAACAAGCTTAGGGAGG - Intronic
1028102353 7:86836832-86836854 ATTAGGAAACAGAGTCAGAAAGG + Intronic
1028385512 7:90248850-90248872 ATGAGGAAACAGACACAGAAAGG - Intronic
1028618812 7:92801485-92801507 ATGAGGAAACAGGCAGGGAATGG + Intronic
1028673572 7:93432730-93432752 ATGAGAAATCAGGCTCAGTGGGG - Intronic
1028727358 7:94102463-94102485 ACAAGAAAACAAGCTCAGGAGGG + Intergenic
1028912076 7:96219526-96219548 ATGAGGAAACAGGCCCAGAGGGG - Intronic
1028915423 7:96253451-96253473 ATGAGAAAACAGGCTCACATGGG + Intronic
1029115003 7:98232223-98232245 ATGGGGAGACAGGCTCGGGAGGG + Intronic
1029260355 7:99298109-99298131 ATGAGGAAACATGTTCAGCAAGG - Intergenic
1029371402 7:100153344-100153366 ATTACGGCACAGGCTCAGGAAGG - Intronic
1029581908 7:101441935-101441957 ACCAGGAAACAGGCTCAGAGAGG + Intronic
1029603798 7:101586135-101586157 ATGAGGACACTGGCTCAGAGAGG + Intergenic
1029669440 7:102019121-102019143 AGGAGGATAAAGGCTGAGGATGG - Intronic
1030009885 7:105155343-105155365 ATGAGGAAACAGACTCACAGAGG + Intronic
1030078896 7:105760359-105760381 ATGAGGAAACAGGCTCTGAGAGG + Intronic
1030296532 7:107934467-107934489 AGGAAGAAACAGGCTCAGTTAGG + Intronic
1030665934 7:112278625-112278647 TTGTGGAAACAGGCTAAGAAAGG + Intronic
1030807288 7:113933372-113933394 ACTAGGAAACAGGCACAGGGTGG - Intronic
1030903266 7:115150325-115150347 CTGAGGATACAGACACAGGATGG - Intergenic
1031337993 7:120561486-120561508 GTGAGGAAACAGATTCAGAAAGG + Intronic
1031514251 7:122682782-122682804 ATGAGGAAACTGACCCAGAATGG - Intronic
1031830589 7:126620632-126620654 ATGAGAAAACAGGCTTAAGGAGG - Intronic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1031976931 7:128100045-128100067 ATGAGGGAACCGCCTCAGAAAGG - Intergenic
1032001934 7:128271322-128271344 CTGAGGAAACAGGCCCAGAATGG - Intergenic
1032242842 7:130178718-130178740 AGGAGGAAAAAAGCACAGGAGGG - Intronic
1032327583 7:130945702-130945724 ATGAGGTAGGAGGCTCAGCACGG - Intergenic
1033179742 7:139164320-139164342 ATGAGGAAACAGGCTCAGAAAGG + Intronic
1033242655 7:139693167-139693189 ATGAGGAAACAAGCTCAAGGAGG - Intronic
1033558623 7:142510167-142510189 ATCAGGATAGAAGCTCAGGAAGG - Intergenic
1033640796 7:143262092-143262114 ATGAGGAAATAGGTTCAGAGAGG + Intronic
1034336211 7:150325116-150325138 ATGAGGAAAGAGGCTCACTGTGG + Intronic
1034639501 7:152591397-152591419 ATAAGGAAACAGGCCCACAAAGG - Intergenic
1034946370 7:155264772-155264794 TTGAGGGTACAGGCTCAGAAAGG - Intergenic
1035050762 7:155997967-155997989 AAGAGGAACCAGGCTCAGGGAGG - Intergenic
1035226968 7:157439049-157439071 TTTAGGACACAGGCTGAGGAGGG - Intergenic
1035360245 7:158307784-158307806 AGGAGGAAACTGGGTCATGAGGG + Intronic
1035637416 8:1156877-1156899 ATGAGGAGGCTGACTCAGGAAGG + Intergenic
1036619653 8:10416077-10416099 CTGGGGAAGCAGGCTCAGGCAGG - Intronic
1036633224 8:10529872-10529894 AGGAGGACACAGCCTCAGGCTGG - Intronic
1036652090 8:10651092-10651114 ATCAGGAAGCAGGCTCAGAAGGG + Intronic
1036770197 8:11573410-11573432 GTGAGGAAACAGGCTTAGGGAGG - Intergenic
1036784399 8:11676411-11676433 ATGAGGTAACCGGCTCAGAGAGG - Intergenic
1036828140 8:11995611-11995633 ATGAGGAAACAGATTTAGAACGG - Intronic
1037122524 8:15306053-15306075 TGGAAGGAACAGGCTCAGGAGGG - Intergenic
1037723203 8:21462126-21462148 ATGAGGAAATAGGTTCATGGAGG + Intergenic
1037807168 8:22064930-22064952 ATAAGGAAACGGGCTCAGAGAGG - Intronic
1037918228 8:22785680-22785702 ATGAGGACTCAGGCTCAGGGAGG - Intronic
1037921465 8:22809244-22809266 ACGAGGAAACAGATTCAGGGAGG + Intronic
1037961651 8:23102585-23102607 GGGAGGGAGCAGGCTCAGGATGG + Exonic
1037969875 8:23164336-23164358 GGGAGGGAGCAGGCTCAGGATGG - Intergenic
1038290415 8:26244273-26244295 GTGAGGAAACAGACTCAGAAAGG - Intergenic
1038417948 8:27411276-27411298 AAGAGGATTCAGGCTGAGGAAGG + Intronic
1038421728 8:27438027-27438049 ATGAGGACACAGGGTCAGAGAGG - Intronic
1038564788 8:28610677-28610699 ATGAAGAAATGGGCTCAGGTTGG + Intronic
1038777121 8:30541207-30541229 ATGAGGAAACAGATGCAGAAAGG - Intronic
1039635430 8:39159560-39159582 AGGAAGAAAGAGGCTGAGGAAGG - Intronic
1039931246 8:41991715-41991737 CTTAGGAAACAGGCTGAAGATGG + Intronic
1039952550 8:42183297-42183319 AGGGGGAAAAAGGCTCAGGCCGG - Intronic
1041053661 8:53961010-53961032 ATGAGGAAGCAGGCCCAGAAAGG - Intergenic
1042241466 8:66668082-66668104 CTTAGGAAACAGGCCCAGAAAGG + Intronic
1042917663 8:73891201-73891223 ATAAGGAAACAGGCTTAGAGAGG + Intergenic
1043442641 8:80289833-80289855 ATGAGAAAACAGGCTCAGAGAGG + Intergenic
1043487272 8:80710393-80710415 ATGAGGAAACAGCCACAGAGAGG + Intronic
1043863507 8:85350001-85350023 TAAAGGAAACAGGATCAGGAAGG - Intronic
1043880152 8:85532982-85533004 GTGTGGAAACAGTCTCAGAACGG + Intergenic
1044106269 8:88210978-88211000 ATGAGGAAACAAGTTGAGAAGGG + Intronic
1044481206 8:92691052-92691074 ATTATGAAACAGGCTAAGCAAGG - Intergenic
1044584577 8:93857582-93857604 ATGAGGAAACAGCTTCAAGAAGG - Intergenic
1044626135 8:94236010-94236032 GGGAGGAAACAGGCTCAGAGAGG - Intergenic
1044648429 8:94468994-94469016 CTGAGAAAACAGGTTCAGGCTGG + Intronic
1044672586 8:94698069-94698091 AAGAGGAAACAGGCTGGGCACGG - Intronic
1044803160 8:95977724-95977746 AGGAAGAAACAGGCTCAGAGAGG - Intergenic
1044891852 8:96844513-96844535 ATGAGAAAACAGGCTCACACTGG - Intronic
1044911917 8:97068786-97068808 ATGAAGAAACAGACTCATAAGGG + Intronic
1044938821 8:97319592-97319614 ATGAAGAAACAGGCCCAGTGAGG - Intergenic
1045051460 8:98330904-98330926 ATGAGGAAACTGGCTCAGAGAGG + Intergenic
1045061810 8:98417629-98417651 AGGGGGAAACAGGCACAGAAAGG - Intronic
1045653008 8:104359454-104359476 ATAAGAAAACAGGCTCAGAGAGG - Intronic
1045775758 8:105800767-105800789 ATGAGGAAACACGCTGAAGGAGG - Intronic
1046031525 8:108787962-108787984 ATGTGGAAACAGGCTCAGAGAGG + Intergenic
1046103727 8:109643801-109643823 ATGAGGAAACAGGCTAAATGGGG + Intronic
1046961992 8:120122454-120122476 ATGAGGAGTTAGGCTCAGGGAGG + Intronic
1047154486 8:122301653-122301675 ATGAGAAAAAAGGCTCAGAAAGG + Intergenic
1047218861 8:122902415-122902437 CTGAGGAAACAGGCACAGAGAGG - Intronic
1047372373 8:124266745-124266767 AAGAGGAATCAGGCCCAGAAAGG + Intergenic
1047599855 8:126415042-126415064 AAGGGGAAACATTCTCAGGAAGG + Intergenic
1047713839 8:127577381-127577403 ATGAGAAAACAGGCTCAGACAGG - Intergenic
1047982621 8:130198669-130198691 ACGAGGAAACAGGCTTAGAGAGG + Intronic
1048018478 8:130518356-130518378 ATGAGGAAACTGGCTCAGAGAGG - Intergenic
1048140794 8:131792226-131792248 TTGAGGAAACAGGCTCAGAGAGG + Intergenic
1048299688 8:133242286-133242308 GTGAGGAAACTGGCTCAGACAGG - Intronic
1048470383 8:134699452-134699474 ATTAGGAAACGGGCTCAGCAGGG - Intronic
1048511973 8:135071290-135071312 ATGAAGAAATAGGATCAGAAAGG - Intergenic
1048664819 8:136649174-136649196 ATGAGGAAACATGCACTGCAGGG - Intergenic
1048675833 8:136778799-136778821 GTGAGGAAACAGGATCTGGATGG + Intergenic
1049223770 8:141440065-141440087 ATGAGGAAACAGGCCCAGAGAGG + Intergenic
1049302352 8:141878343-141878365 GTGGGGAATCAGGCCCAGGAAGG + Intergenic
1049371889 8:142271854-142271876 ATGAGGAAACAGACCCAGAGAGG + Intronic
1049414620 8:142489581-142489603 GTGGGGAAACAGGCTCAGAGAGG + Intronic
1050068838 9:1789327-1789349 ATGAGGACACAGGACCAGGAAGG - Intergenic
1050495665 9:6239265-6239287 ATAAGGAAGCTTGCTCAGGAGGG + Intronic
1050964433 9:11780506-11780528 ATTAGAAAACAGGCTCAAAATGG - Intergenic
1051167705 9:14282700-14282722 ATCAGGAAACAGGTTCCTGAAGG + Intronic
1051189878 9:14500160-14500182 ATGAGGAAACAGGCACAGAGAGG + Intergenic
1051371196 9:16360564-16360586 ATGAGGAGAAAGGCTGAGGTGGG - Intergenic
1051854642 9:21550002-21550024 ATGAGGAGACAGGATCAGAGAGG - Intergenic
1051901301 9:22044702-22044724 ATGGGGATACAGGCACAGGAAGG - Intergenic
1052041224 9:23741364-23741386 ATGAGGAAGGAGGCACACGAGGG + Intronic
1052236499 9:26217459-26217481 ATGCAGAAGCAGGCACAGGAAGG + Intergenic
1052820062 9:33131276-33131298 GTGAGGAAACAGGCTCAGAGAGG - Intronic
1053153087 9:35755175-35755197 ATGAGGAAACAGGCTCAGAGAGG - Exonic
1053416188 9:37948242-37948264 ATGAGTAAACAGGTTCACGGAGG - Intronic
1053432155 9:38049649-38049671 AAAAGGAAACAGGCTCAGAGAGG + Intronic
1053471994 9:38353192-38353214 ATGTGGAAACAGGCTCAGAGGGG - Intergenic
1054974765 9:71129550-71129572 ATGAGGAAATAGCCTCAGACTGG + Intronic
1055081036 9:72267733-72267755 ATCAGGAAACAGGTTCAGAAAGG + Intergenic
1055394204 9:75856432-75856454 ATGAGGAAACTGGCTTAGAGAGG - Intergenic
1055671452 9:78610595-78610617 ATGAGGAAATAGACTCGGAAAGG + Intergenic
1055761463 9:79613372-79613394 ATCAGCAAACAGGCACAGGTTGG + Intronic
1056271631 9:84953423-84953445 GTGAGGAAACAGGCCCAGAGAGG + Intronic
1056606832 9:88092927-88092949 AGGAGGAAGCTGGCTCAGGAAGG + Intergenic
1057109534 9:92454747-92454769 GTGAGGAAGCAGGCTCAGAGAGG + Intronic
1057218471 9:93242885-93242907 ATGTGGTGACAGCCTCAGGAAGG + Intronic
1057313751 9:93956530-93956552 GTAAGGAAACAGGCCCAGAAAGG - Intergenic
1057479366 9:95432504-95432526 ATGGGGAAACAAGCTCAGGGGGG - Intergenic
1057529544 9:95831909-95831931 CTGAGAAAACAGCCTCAGGAAGG - Intergenic
1057766091 9:97920585-97920607 ATGAGGAAAAAGCCTGAGCAGGG - Intronic
1057825025 9:98366117-98366139 ATGAGGAAACTGGTTCAGAGTGG - Intronic
1057900970 9:98947959-98947981 ATGGGAAAACAGGCTCAGAGTGG - Intronic
1057928068 9:99170573-99170595 ATGGGGAAACAGGCTGAGAAAGG + Intergenic
1058479786 9:105380154-105380176 ATGGAAAAACAGGCTCAGAATGG + Intronic
1058581129 9:106458883-106458905 GTGAGGAAACAGGCTCAGAGAGG - Intergenic
1058635444 9:107033867-107033889 ATGAAGAAACAGACTAAGGAAGG - Intergenic
1058665492 9:107310822-107310844 ATGAAGAAACAGGCTTAGAAAGG + Intronic
1058752882 9:108056168-108056190 ATGAGCAAACAGGCCCAGAGAGG + Intergenic
1059206331 9:112469782-112469804 ATGAGGAAACAGACTCAAAAAGG - Intronic
1059377925 9:113900472-113900494 ATGAGTAAACAGGCACAGAGAGG + Intronic
1059431908 9:114255431-114255453 ATGGGGAGACAGGCCCAGGACGG - Intronic
1059439599 9:114299570-114299592 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1059502508 9:114767006-114767028 ATAAGGAAACAGGCTGGGCATGG - Intergenic
1059672790 9:116507347-116507369 ATGGAGAAACAGGCACAGAAGGG + Intronic
1059756379 9:117297521-117297543 AAGAGGAGACATACTCAGGAAGG + Intronic
1059757785 9:117309999-117310021 ATGAAGAAACAGGCTCAGAAAGG - Intronic
1059758983 9:117320511-117320533 ATGAGGAAATAGGTTCAGAGAGG + Intronic
1059780914 9:117526262-117526284 ATGAGGAAACAGGTTCAAAGAGG + Intergenic
1059805613 9:117797034-117797056 ATGAGGAAGCATGATCATGATGG + Intergenic
1059825240 9:118020799-118020821 ATGAGGAAACAGGTTCAAAATGG - Intergenic
1059939006 9:119339695-119339717 ATGAGGAAACAAGCTCAGAGAGG + Intronic
1059969157 9:119647238-119647260 ATGAGAAAACAAGCTCAGAGAGG + Intergenic
1059980300 9:119764225-119764247 ATGAGGAGACTAGCTCAGAAAGG - Intergenic
1060027074 9:120182357-120182379 ATGAGGAAACAGACTCACATAGG - Intergenic
1060048270 9:120358419-120358441 ATGAGGAAACAGACCCAGAGAGG + Intergenic
1060066045 9:120501971-120501993 ATGAGGAAACAGGCTGAGACAGG + Intronic
1060069968 9:120537663-120537685 ATGATGAAACAGGCACAGTGTGG - Intronic
1060128862 9:121075674-121075696 ATGAGGAAACATGATCAGGAAGG - Intronic
1060237507 9:121876078-121876100 ATTAGGAAACAGGCCCAGAGAGG + Intronic
1060239642 9:121891721-121891743 CTGAGGATACAGGCTCAGAGAGG + Intronic
1060276128 9:122184159-122184181 ATGAGGAAACAGGCTCAGTGGGG + Intronic
1060279260 9:122204951-122204973 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1060451365 9:123743832-123743854 TTAAGGAAACAGGCTCAGAAAGG + Intronic
1060590007 9:124810687-124810709 ACGAGGAGACAGGCTCAGAGAGG + Exonic
1060629816 9:125145665-125145687 ATGAGGAAATAGGCTTAGAGAGG - Intergenic
1060872700 9:127055599-127055621 ATGAGGAAACAGACACAGAAAGG + Intronic
1060900977 9:127258012-127258034 ATGAGGAAACAGGCTCAGAGAGG + Intronic
1060916532 9:127395166-127395188 ATAAGGAAATAGGCTTAGGAAGG + Intergenic
1061036259 9:128115867-128115889 ATGAGGAACCTGGCACAGGCTGG + Intergenic
1061047900 9:128177211-128177233 AAGAGGAAACAGGCACAGGGTGG + Intronic
1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG + Intronic
1061106282 9:128533131-128533153 ATGATGAAACAGGCTGGGCATGG + Intronic
1061147536 9:128808676-128808698 ATGAGGAGACTGGCTCAGCAAGG + Exonic
1061193188 9:129094052-129094074 ATGAGGAAGCAGGCTTAGCGAGG - Intergenic
1061379246 9:130244182-130244204 ATGAGGAAACAGCTTCAGAGAGG + Intergenic
1061490702 9:130942368-130942390 ATGAGGAAACTGATTCAGAAAGG + Intergenic
1061510434 9:131057656-131057678 AAGAGGAAGCAGGCTCAGGGAGG - Intronic
1061626041 9:131841319-131841341 ATGAGACAACAGGCTCAGAGAGG - Intergenic
1061684759 9:132266227-132266249 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1061799111 9:133104477-133104499 AGGGGGAGGCAGGCTCAGGAAGG - Intronic
1061937620 9:133866992-133867014 TTGAGGAAACAGGCTCAGGGAGG - Intronic
1061945124 9:133904481-133904503 ATGAGTGAGCAGGCTCAGGACGG + Intronic
1061976305 9:134069609-134069631 GTAAGGAAACAGGCTCAGTGAGG + Intergenic
1062015492 9:134289127-134289149 AGGTGGAAACAGGCACAGGCTGG + Intergenic
1062055924 9:134469824-134469846 GTGAGAACCCAGGCTCAGGAGGG - Intergenic
1062056560 9:134472106-134472128 AGGAGGACCCAGGCTCAGGAAGG - Intergenic
1062271508 9:135711972-135711994 ATGAGCATACAGGCTCAGGGAGG + Intronic
1062434297 9:136539888-136539910 AAGAGGAAGGAGGCTCAGGCGGG - Intronic
1062519739 9:136952664-136952686 GAGGGGAAACAGGCTCGGGAAGG + Intronic
1203630193 Un_KI270750v1:67000-67022 AGGAGGAAACAGACACAGGCAGG + Intergenic
1203631216 Un_KI270750v1:74046-74068 GTGAGGAAACAGGCTGCGGATGG - Intergenic
1185819100 X:3184614-3184636 ATGAGGACACAGGCTCAGTTGGG + Intergenic
1186780023 X:12903175-12903197 AGGAGGAAACAGGCTCATAAAGG - Intergenic
1186890313 X:13953429-13953451 ATGAGGAAACAGGCTCAAAGGGG - Intergenic
1186925586 X:14330126-14330148 ATGAGGAAAGAGGTTGAGGTAGG - Intergenic
1187206670 X:17188090-17188112 CTAAGAAAACAGGCTCAGAAAGG - Intergenic
1187441332 X:19323318-19323340 ATGAAGAAACAGGCACATGGGGG - Intergenic
1187862601 X:23696583-23696605 ATGAGGAAACAGGCTTAGAGAGG - Intergenic
1187898291 X:24003211-24003233 ATAAGGAAACAGGCACAGAAAGG - Intronic
1188618188 X:32185347-32185369 GTGAAGAAACAGATTCAGGAAGG - Intronic
1189181676 X:39010618-39010640 CTCAGAGAACAGGCTCAGGATGG + Intergenic
1189279705 X:39812531-39812553 GGGAGGAAACAGGCTCGGAAGGG + Intergenic
1189755749 X:44269802-44269824 AAAAGGAAACAGGCTTAGGGAGG - Intronic
1190689105 X:52898882-52898904 ATGAGGTAACAGGATCAGAGAGG - Intronic
1190696878 X:52956910-52956932 ATGAGGTAACAGGATCAGAGAGG + Intronic
1190756996 X:53409795-53409817 ATGAGGAAACAGGTACAGAAAGG - Intronic
1191688971 X:63920703-63920725 ATGGGGAAACAGGATCAGACAGG - Intergenic
1191765051 X:64689204-64689226 ATAAAGAATCAGGCTCAGGAGGG + Intergenic
1191845534 X:65544886-65544908 TTGAGGAAACAGACTTAGAAGGG - Intergenic
1191900103 X:66032108-66032130 AAGAGGAAACAGAGTCAGAAAGG - Intronic
1192538113 X:71945901-71945923 TTGGGGAAACAGGCTCAGAGGGG + Intergenic
1192627453 X:72745094-72745116 ATAAGAAAACAGGCTTAGAAAGG - Intergenic
1192654255 X:72975719-72975741 ATAAGAAAACAGGCTTAGAAAGG + Intergenic
1192824523 X:74681478-74681500 ATGAGGCAATAGGCGCAGGGTGG - Intergenic
1192859337 X:75048981-75049003 ATGAGGAAACAGGCCAAGTTGGG - Intergenic
1192929105 X:75785895-75785917 ATGAGGAAACTGGGTCATGGAGG + Intergenic
1193853304 X:86567108-86567130 AAGAGGAAACAAGCTTAGGGTGG + Intronic
1193864558 X:86715175-86715197 TTGAGGAAACATGTTCAGGAGGG - Intronic
1194949044 X:100102878-100102900 CTGAGTAAACAAGCTCAGAAAGG - Intergenic
1195009116 X:100718001-100718023 ATGGGGAAACAGACTCAAGGAGG - Intronic
1195135546 X:101904071-101904093 ATGAGGAGATTGGCTCAGAAAGG - Intronic
1195385151 X:104307004-104307026 ATGGGAAAACAGGCTCAGAGTGG - Intergenic
1195679548 X:107534073-107534095 ATGATGAAACAGGTCCAGAATGG - Intronic
1195781016 X:108464183-108464205 ATGAAGAAAGGGGATCAGGAAGG - Intronic
1195921839 X:109991398-109991420 ATGAGGAAAAAGGCTCTGAGAGG + Intergenic
1196002537 X:110802204-110802226 ATAAGGAAACAAGCTCAGAAAGG - Intergenic
1196007899 X:110854951-110854973 ATAAGGAAACAGGCTTAGAGAGG - Intergenic
1196027043 X:111052093-111052115 ATGAGGAGCTAGGCTCAGGCAGG - Intronic
1196045991 X:111257026-111257048 ATGAGGAAGCAAGCTCAGAGAGG + Intronic
1196577729 X:117339425-117339447 TAGAGGAAACAGGGTCTGGAGGG + Intergenic
1196818805 X:119686559-119686581 AGGAGGCCACATGCTCAGGAGGG - Intronic
1196906304 X:120439858-120439880 AAGTGGAAACAGGATCAGGAAGG + Intronic
1196915412 X:120529388-120529410 AAGAGGAAACAAGATCAGCATGG + Intronic
1197735437 X:129847380-129847402 ATGAAGAAATAGTCTCAGAAAGG - Intergenic
1198056302 X:132998915-132998937 GTGAAGAAACAGGCCCAGAAAGG + Intergenic
1198295864 X:135285703-135285725 ATTTGGAAACAGGCTTAGAACGG + Intronic
1198377066 X:136050725-136050747 AGGAAGAGACAGGCTCAGGCAGG - Intergenic
1198399687 X:136256819-136256841 ATGAGGAAGCAGGCCCAGGGAGG + Intergenic
1198522362 X:137465854-137465876 ATGAGGAAACAGAGTCAGAGAGG + Intergenic
1198570229 X:137947060-137947082 GTGAGGAAATAGGCTCAGTGAGG + Intergenic
1198641878 X:138765112-138765134 ATGAAGAAAGAGGCTCAGTGAGG - Intronic
1198684278 X:139211256-139211278 ATGAGGAAACAAGCTCAGAGAGG + Intronic
1198783803 X:140265746-140265768 ATGAGAAAACAGGCTCAGTGAGG - Intergenic
1199665835 X:150095719-150095741 ATGAGGAAACAGAGACAGGGAGG - Intergenic
1200343944 X:155429363-155429385 ATGAGGAAACAGAATCAGGTGGG - Intergenic