ID: 904475447

View in Genome Browser
Species Human (GRCh38)
Location 1:30762057-30762079
Sequence CTGGGTTCGGGGCAGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904475447_904475461 19 Left 904475447 1:30762057-30762079 CCTGTCTCCTGCCCCGAACCCAG No data
Right 904475461 1:30762099-30762121 GGCCTACACGTGCAACCCACAGG No data
904475447_904475458 -3 Left 904475447 1:30762057-30762079 CCTGTCTCCTGCCCCGAACCCAG No data
Right 904475458 1:30762077-30762099 CAGCACGGTCACCAGGGGTCAGG No data
904475447_904475462 20 Left 904475447 1:30762057-30762079 CCTGTCTCCTGCCCCGAACCCAG No data
Right 904475462 1:30762100-30762122 GCCTACACGTGCAACCCACAGGG No data
904475447_904475459 -2 Left 904475447 1:30762057-30762079 CCTGTCTCCTGCCCCGAACCCAG No data
Right 904475459 1:30762078-30762100 AGCACGGTCACCAGGGGTCAGGG No data
904475447_904475454 -9 Left 904475447 1:30762057-30762079 CCTGTCTCCTGCCCCGAACCCAG No data
Right 904475454 1:30762071-30762093 CGAACCCAGCACGGTCACCAGGG No data
904475447_904475455 -8 Left 904475447 1:30762057-30762079 CCTGTCTCCTGCCCCGAACCCAG No data
Right 904475455 1:30762072-30762094 GAACCCAGCACGGTCACCAGGGG No data
904475447_904475453 -10 Left 904475447 1:30762057-30762079 CCTGTCTCCTGCCCCGAACCCAG No data
Right 904475453 1:30762070-30762092 CCGAACCCAGCACGGTCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904475447 Original CRISPR CTGGGTTCGGGGCAGGAGAC AGG (reversed) Intergenic
No off target data available for this crispr