ID: 904475646

View in Genome Browser
Species Human (GRCh38)
Location 1:30763084-30763106
Sequence CTGCATTTACAGAAGGTCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904475646_904475650 -7 Left 904475646 1:30763084-30763106 CCTTCGACCTTCTGTAAATGCAG No data
Right 904475650 1:30763100-30763122 AATGCAGGTGCAATGCCTGGAGG No data
904475646_904475649 -10 Left 904475646 1:30763084-30763106 CCTTCGACCTTCTGTAAATGCAG No data
Right 904475649 1:30763097-30763119 GTAAATGCAGGTGCAATGCCTGG No data
904475646_904475652 9 Left 904475646 1:30763084-30763106 CCTTCGACCTTCTGTAAATGCAG No data
Right 904475652 1:30763116-30763138 CTGGAGGCACAGAAGCCATTTGG No data
904475646_904475653 10 Left 904475646 1:30763084-30763106 CCTTCGACCTTCTGTAAATGCAG No data
Right 904475653 1:30763117-30763139 TGGAGGCACAGAAGCCATTTGGG No data
904475646_904475654 11 Left 904475646 1:30763084-30763106 CCTTCGACCTTCTGTAAATGCAG No data
Right 904475654 1:30763118-30763140 GGAGGCACAGAAGCCATTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904475646 Original CRISPR CTGCATTTACAGAAGGTCGA AGG (reversed) Intergenic
No off target data available for this crispr