ID: 904481211

View in Genome Browser
Species Human (GRCh38)
Location 1:30794668-30794690
Sequence AATGGTAGTACACTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904481204_904481211 14 Left 904481204 1:30794631-30794653 CCGCTAAAGGGAATGAGAAGAAG No data
Right 904481211 1:30794668-30794690 AATGGTAGTACACTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904481211 Original CRISPR AATGGTAGTACACTGATTGT GGG Intergenic
No off target data available for this crispr