ID: 904482388

View in Genome Browser
Species Human (GRCh38)
Location 1:30802087-30802109
Sequence GATCCCTGGTTGAGTTTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904482388_904482398 25 Left 904482388 1:30802087-30802109 CCTGCAAAACTCAACCAGGGATC No data
Right 904482398 1:30802135-30802157 CCCCTCTCCTCTGCTGCCTCTGG No data
904482388_904482392 -8 Left 904482388 1:30802087-30802109 CCTGCAAAACTCAACCAGGGATC No data
Right 904482392 1:30802102-30802124 CAGGGATCTCAGCCCTAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904482388 Original CRISPR GATCCCTGGTTGAGTTTTGC AGG (reversed) Intergenic
No off target data available for this crispr