ID: 904483223

View in Genome Browser
Species Human (GRCh38)
Location 1:30807150-30807172
Sequence GTGCCCTCCCCAAGGTCACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904483217_904483223 23 Left 904483217 1:30807104-30807126 CCAGTTTGCAGAGGCGGGAACTG No data
Right 904483223 1:30807150-30807172 GTGCCCTCCCCAAGGTCACACGG No data
904483216_904483223 24 Left 904483216 1:30807103-30807125 CCCAGTTTGCAGAGGCGGGAACT No data
Right 904483223 1:30807150-30807172 GTGCCCTCCCCAAGGTCACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904483223 Original CRISPR GTGCCCTCCCCAAGGTCACA CGG Intergenic
No off target data available for this crispr